G43377



Basic Information


Item Value
gene id G43377
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 3862045 ~ 3862514 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU49234
GTAAATGAAAATTCTTTTAGAACACAAGGCAGAGAATGCTGCTCAACTGAGATCTGTGTTAAATGTTGAATGGCATCTCCTCTACTATATACACATCAGCATCTGGTTTTAATTTAACAGCATGACAGCTGATAACTGCACTTTAATTGAATGAAAGAGAAATAAGGGGCAAACATGAAAAAATAAATCATTCGAATGAGCCACTGATCTACACTCCAATTTGAAAACTATTACCACAAAAAGGCAAATAAATGAAATATGACAGTCATTAACTTAGCATCTATGCTGATGAATGTATGCTTTCATGAGTCTTTTGCATGAAAGCAACATGCTACATTTACTGTCTTTGATGCTCTCAGGAAGGGATCTCTTGCCCCATCATGTTTTTAAATATTTTAAGGTACATTTCCACTCAGGCACCATGAAGATGTGTCATGTGCAGGCAGAGCGAGGTGTAAGCAGTAGACTGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU49234 True 470 lncRNA 0.37 1 3862045 3862514

Neighbor


gene id symbol gene type direction distance location
CI01000006_03853517_03857679 ADSSL, PURA2 coding downstream 4366 3853517 ~ 3857679 (-)
CI01000006_03850934_03852259 NA coding downstream 9741 3850934 ~ 3852304 (-)
CI01000006_03841667_03847765 STX5AL, STX5 coding downstream 14280 3841321 ~ 3847765 (-)
CI01000006_03814498_03821222 NA coding downstream 40823 3814433 ~ 3821222 (-)
CI01000006_03782744_03792823 ESRRA coding downstream 68761 3782699 ~ 3793284 (-)
CI01000006_04131548_04142994 SUPT6H coding upstream 268846 4131360 ~ 4142994 (-)
CI01000006_04144468_04144836 NA coding upstream 281954 4144468 ~ 4145103 (-)
CI01000006_04154152_04182430 CALN2, CALN1 coding upstream 291581 4154095 ~ 4182430 (-)
CI01000006_04232222_04238240 NF2B, NF2 coding upstream 369394 4231908 ~ 4238240 (-)
CI01000006_04244321_04245262 NA coding upstream 381380 4243894 ~ 4247214 (-)
G43378 NA non-coding downstream 337 3861481 ~ 3861708 (-)
G43368 NA non-coding downstream 55196 3806636 ~ 3806849 (-)
G43360 NA non-coding downstream 85593 3776221 ~ 3776452 (-)
CI01000006_03737857_03742809 GNG4, GNG2, GNG3 non-coding downstream 119613 3736572 ~ 3742820 (-)
G43357 NA non-coding downstream 122298 3739097 ~ 3739747 (-)
G43379 NA non-coding upstream 599 3863113 ~ 3863338 (-)
G43380 NA non-coding upstream 1027 3863541 ~ 3863768 (-)
G43383 NA non-coding upstream 3431 3865945 ~ 3866197 (-)
G43393 NA non-coding upstream 16514 3879028 ~ 3879651 (-)
G43220 NA non-coding upstream 25392 3887906 ~ 3888705 (-)
G43102 NA other downstream 928061 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 1235859 2624436 ~ 2626776 (-)
G42934 NA other downstream 1279839 2523776 ~ 2582206 (-)
CI01000006_02285649_02294759 NA other downstream 1567047 2284994 ~ 2296494 (-)
G42667 NA other downstream 1971289 1888988 ~ 1890756 (-)
G43549 NA other upstream 489996 4352510 ~ 4355428 (-)
CI01000006_04560607_04560993 NA other upstream 696995 4559509 ~ 4562068 (-)
CI01000006_06974359_06976736 NA other upstream 3110710 6973224 ~ 6976872 (-)
CI01000006_07500281_07507754 NA other upstream 3640631 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 6620342 10453613 ~ 10484006 (-)

Expression



Co-expression Network