G41791


Basic Information

Item Value
gene id G41791
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4009704 ~ 4009992 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU47437
AAAACCAAAGAATATAGTTCTGATGTGCAGCAAAAGATTGTTGAGCTTCACAAAATAGAAAGTGGCTGTAAGAAAATAGCTAAAGCATTGAAAATCCCCATTTCCACTATCAGGGCAATAATTAAGAAGTTCCAATCAACTAAAGATGTTACAAATCTGCCTGGAAGAGGACGTGTGTCTAAATCGTCCTAATGCGCGGTGAGGAGGAGAGTTTGAGTGGCCTAAGACTCTCCAAGGATCACAGCTGGAGAATTGTAGAGATTAGTTGAGTCTTGAGTCTCAGAAAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU47437 True 289 lncRNA 0.40 1 4009704 4009992

Neighbor

gene id symbol gene type direction distance location
CI01000006_03941900_03945253 EIF4EBP3 coding upstream 64003 3941299 ~ 3945701 (+)
CI01000006_03893432_03940454 ANKHD1 coding upstream 68743 3893432 ~ 3940961 (+)
CI01000006_03888048_03891012 NA coding upstream 118226 3887373 ~ 3891478 (+)
CI01000006_03883341_03885377 NA coding upstream 123678 3882789 ~ 3886026 (+)
CI01000006_03858455_03862082 RCE1B coding upstream 147336 3858455 ~ 3862368 (+)
CI01000006_04034081_04045505 NA coding downstream 24089 4034081 ~ 4047794 (+)
CI01000006_04050327_04089669 GRIA1B coding downstream 40027 4048960 ~ 4091323 (+)
CI01000006_04100433_04105606 NIPAL4 coding downstream 90070 4100062 ~ 4105617 (+)
CI01000006_04107814_04117460 TLCD1 coding downstream 97822 4107814 ~ 4117662 (+)
CI01000006_04124413_04127728 RAB34 coding downstream 114421 4124413 ~ 4127771 (+)
G41751 NA non-coding upstream 59013 3949279 ~ 3950691 (+)
G41747 NA non-coding upstream 138475 3870159 ~ 3871229 (+)
G41744 NA non-coding upstream 145345 3864131 ~ 3864359 (+)
G41499 NA non-coding upstream 155828 3850469 ~ 3853876 (+)
G41743 NA non-coding upstream 159678 3849793 ~ 3850026 (+)
G41792 NA non-coding downstream 2785 4012777 ~ 4013031 (+)
G41795 NA non-coding downstream 19085 4029077 ~ 4029572 (+)
G41774 NA non-coding downstream 84324 4094316 ~ 4095218 (+)
G41763 NA non-coding downstream 111286 4121278 ~ 4123226 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 273726 3734554 ~ 3736035 (+)
G41591 NA other upstream 1170283 2836167 ~ 2839421 (+)
G41424 NA other upstream 1349134 2645662 ~ 2660570 (+)
G41170 NA other upstream 2313883 1692065 ~ 1695821 (+)
G40768 NA other upstream 3516678 488407 ~ 493026 (+)
G41996 NA other downstream 1107214 5117206 ~ 5124149 (+)
G43896 NA other downstream 1760097 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 2098492 6104927 ~ 6109820 (+)
CI01000006_06122278_06122736 NA other downstream 2112043 6122035 ~ 6122751 (+)
CI01000006_07167131_07168925 NA other downstream 3156797 7166778 ~ 7168925 (+)

Expression


Co-expression Network