G41937


Basic Information

Item Value
gene id G41937
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4625521 ~ 4625779 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU47623
TAGAAAGCAACAAAATTACCACATTCAAGGTCCAGAAAAGTAGTAAAGACATCATTAAAACATGTGACTACAGTGGTTCAACCTTAATGTTATGAAGAGACGAGAATACTTTTTGTGAGCAAAAACAAAAGATAAATAATGACTTTATTCAACAATTTCGTCTCTACCCTGTCAGTCTCCTACGCAGGTGACGCAGTGCAGCGCTTCCGTGTTTACGGCAGAATGCCGACTCAGTATTGTCCGACGCTGTTCACGTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU47623 True 259 lncRNA 0.27 1 4625521 4625779

Neighbor

gene id symbol gene type direction distance location
CI01000006_04538991_04543506 RFC2 coding upstream 81917 4538991 ~ 4543604 (+)
CI01000006_04509718_04523326 NFRKB coding upstream 101781 4509718 ~ 4523740 (+)
CI01000006_04493236_04507301 ST14B coding upstream 117323 4493236 ~ 4508198 (+)
CI01000006_04467086_04477770 PPME1 coding upstream 147588 4467086 ~ 4477933 (+)
CI01000006_04455069_04463903 SMS coding upstream 161596 4455069 ~ 4463925 (+)
CI01000006_04703916_04717922 NA coding downstream 77092 4702871 ~ 4718123 (+)
CI01000006_04776793_04779651 IGSF9BB, IGSF9B coding downstream 151014 4776793 ~ 4779687 (+)
CI01000006_04786488_04866122 IGSF9BB, IGSF9B coding downstream 160646 4786425 ~ 4866504 (+)
CI01000006_04931074_04985139 ARHGAP32, ARHGAP32B coding downstream 305295 4931074 ~ 4986173 (+)
CI01000006_04989318_04992332 SC5D coding downstream 363539 4989318 ~ 4992841 (+)
G41889 NA non-coding upstream 2269 4623021 ~ 4623252 (+)
G41904 NA non-coding upstream 169172 4455497 ~ 4456349 (+)
G41892 NA non-coding upstream 231308 4393714 ~ 4394213 (+)
CI01000006_04349756_04355615 FIBPB, FIBP non-coding upstream 267566 4349453 ~ 4357955 (+)
G41860 NA non-coding upstream 299712 4325572 ~ 4325809 (+)
G41939 NA non-coding downstream 1478 4627257 ~ 4627472 (+)
G41887 NA non-coding downstream 2376 4628155 ~ 4628397 (+)
G41940 NA non-coding downstream 4052 4629831 ~ 4630101 (+)
G41885 NA non-coding downstream 6794 4632573 ~ 4634201 (+)
G41965 NA non-coding downstream 61265 4687044 ~ 4687267 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 889543 3734554 ~ 3736035 (+)
G41591 NA other upstream 1786100 2836167 ~ 2839421 (+)
G41424 NA other upstream 1964951 2645662 ~ 2660570 (+)
G41170 NA other upstream 2929700 1692065 ~ 1695821 (+)
G40768 NA other upstream 4132495 488407 ~ 493026 (+)
G41996 NA other downstream 491427 5117206 ~ 5124149 (+)
G43896 NA other downstream 1144310 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 1482705 6104927 ~ 6109820 (+)
CI01000006_06122278_06122736 NA other downstream 1496256 6122035 ~ 6122751 (+)
CI01000006_07167131_07168925 NA other downstream 2541010 7166778 ~ 7168925 (+)

Expression


Co-expression Network