G90489 (crtc2,LOC108436548)


Basic Information

Item Value
gene id G90489
gene name crtc2,LOC108436548
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035906.1
NCBI id CM008309.1
chromosome length 35377769
location 12911538 ~ 12913057 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU121741
TTGGAGAGTGGAAGGCGTTGGTGGTATTGATGCCGAGCTGAGTGAGGGTGGAGGCCAGGTTGCCAGTGCTGTTGCCACCGCTGAGGGAGGGGTAACCAGGCTCGTCTGGGTCGAGTGGTGTTGGCAGTGGGGAGGGAAAGTGCAGGCTGGACAGGTCAGGCAGGGAACCGCCCGTATTCAGTGCAGACGGGACATGAGGGGCATTGGACTGCTGGTCTGGTGAGGGGAATATGGTGATTCCAGGGACTTCACAAGATTTTGGTCTCGAGGTCAGGATAGGTAACTTTTTAGTATCCCATGGCTTCAGAAGTTTTCCTTCATCCAACACATTCTCCTCAATGGGAGGAACCGGGTATGGAAACATTCTCCGTCCATCTCCTTCGTTCAAACCACTGCGTCT

Function

symbol description
crtc2 Predicted to enable cAMP response element binding protein binding activity. Predicted to be involved in positive regulation of CREB transcription factor activity and positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within protein homotetramerization. Predicted to be active in cytoplasm and nucleus. Orthologous to human CRTC2 (CREB regulated transcription coactivator 2).

NR:

description
PREDICTED: CREB-regulated transcription coactivator 2-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU121741 True 400 lncRNA 0.55 5 12911538 12913057

Neighbor

gene id symbol gene type direction distance location
LOC103037789 LOC108436550,LOC108258408,LOC105908885 coding upstream 125358 12762287 ~ 12786180 (+)
ttc24 ttc24 coding upstream 151515 12744236 ~ 12760023 (+)
ankrd34a ankrd34a,LOC107719128,LOC107666885,LOC107714325,LOC107592270 coding upstream 246143 12641421 ~ 12665395 (+)
LOC103036326 txnip,LOC103036326 coding upstream 301491 12607288 ~ 12610047 (+)
hfe2 hfe2 coding upstream 311689 12591058 ~ 12599849 (+)
stk31 NA coding downstream 14153 12927210 ~ 12944738 (+)
mpp6 mpp6,mpp6a,LOC108267518,LOC107749029,LOC107685533,LOC107596657 coding downstream 37560 12950617 ~ 12983779 (+)
LOC103024879 pde11al,LOC108441531,LOC107743218,LOC103364058 coding downstream 254598 13167655 ~ 13192266 (+)
ascc3 ascc3 coding downstream 906034 13819091 ~ 14034911 (+)
sim1 sim1,sim1a,LOC107697271,LOC107661021,LOC103355653,LOC107551726 coding downstream 1123915 14036972 ~ 14056298 (+)
G90459 NA non-coding upstream 118555 12792512 ~ 12792983 (+)
G90452 iqgap3,LOC106605450,LOC105031059 non-coding upstream 169994 12727365 ~ 12741544 (+)
G90382 NA non-coding upstream 309277 12601502 ~ 12602261 (+)
LOC111193294 NA non-coding upstream 380543 12530040 ~ 12530995 (+)
G90370 NA non-coding upstream 402161 12508882 ~ 12509377 (+)
G90502 NA non-coding downstream 89665 13002722 ~ 13016527 (+)
G90512 NA non-coding downstream 107957 13021014 ~ 13021239 (+)
G90513 NA non-coding downstream 108940 13021997 ~ 13022608 (+)
G90604 NA non-coding downstream 349486 13262543 ~ 13262851 (+)
G90605 NA non-coding downstream 353581 13266638 ~ 13266885 (+)
LOC103044318 mtx1a,LOC108436561,LOC107719130,LOC107592302,LOC107666872,LOC107686169,LOC107592422 other upstream 358766 12532301 ~ 12552772 (+)
G90199 cct3 other upstream 754676 12154897 ~ 12156862 (+)
LOC103025787 LOC103025787,LOC100536175,LOC107587908 other upstream 772676 12135279 ~ 12138862 (+)
LOC111193328 NA other upstream 2004366 10903683 ~ 10907172 (+)
LOC103044517 onecutl,LOC108441924,LOC107732477,LOC108268128,LOC107741751,LOC106580869,LOC107663311,LOC107689849 other upstream 2120410 10780102 ~ 10791128 (+)
npy npy other downstream 31729 12944786 ~ 12948250 (+)
eif1b eif1b,zgc:56676,LOC107657782,LOC107599656,LOC105910901,LOC107712803,LOC105027100 other downstream 1358938 14271995 ~ 14274698 (+)
LOC103029466 c1ql3,LOC103029466,LOC108428918,LOC107677106,LOC107599742,LOC107555006 other downstream 1732741 14645798 ~ 14652282 (+)
LOC103045856 NA other downstream 1749600 14662657 ~ 14773367 (+)
alg14 alg14,LOC107739035 other downstream 2247158 15160215 ~ 15216508 (+)

Expression


Co-expression Network