G45154



Basic Information


Item Value
gene id G45154
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 7554097 ~ 7554334 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU51315
ATTAAAGAAATTACTTTTATTCAGCAAGGATGCATTAAATTGATCAAAAGTGACAGTATAGATATTTATAATGTCGCAAAAGGTTTATATTTCAGAGATAACTTTATTTCAGAGAGACTTTCTATTCATCAAATAATCCTGAAAAAAATTGTACACAACTGTTTTCAACATTTATAATAATAATAAATGTTTCTTGAGCAGCAAATTGGCATTTTAGAATGATTTCTGTAGGATCATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU51315 True 238 lncRNA 0.44 1 7554097 7554334

Neighbor


gene id symbol gene type direction distance location
CI01000006_07492187_07498391 NA coding upstream 55423 7492187 ~ 7498674 (+)
CI01000006_07486574_07490054 SLC26A1 coding upstream 63521 7485978 ~ 7490576 (+)
CI01000006_07477200_07478617 RBP4L coding upstream 75311 7476928 ~ 7478786 (+)
CI01000006_07458458_07460310 ATP5I, ATP5IA coding upstream 93787 7458113 ~ 7460310 (+)
CI01000006_07328380_07352585 NA coding upstream 200960 7327983 ~ 7353137 (+)
CI01000006_07577082_07582303 DUSP4 coding downstream 22064 7576398 ~ 7582313 (+)
CI01000006_07692311_07693192 PPP1R3B coding downstream 137906 7692240 ~ 7694117 (+)
CI01000006_07694812_07698078 ERI1 coding downstream 140478 7694812 ~ 7698434 (+)
CI01000006_07699736_07726659 MFHAS1 coding downstream 145402 7699736 ~ 7726997 (+)
CI01000006_07757777_07795187 NNT.L, NNT coding downstream 203192 7757526 ~ 7795258 (+)
G45151 NA non-coding upstream 4087 7549799 ~ 7550010 (+)
G45148 NA non-coding upstream 10028 7543813 ~ 7544069 (+)
G45146 NA non-coding upstream 12239 7541654 ~ 7541858 (+)
G45136 NA non-coding upstream 30467 7523397 ~ 7523630 (+)
G45135 NA non-coding upstream 31479 7522243 ~ 7522618 (+)
G45174 NA non-coding downstream 43046 7597380 ~ 7597757 (+)
G45175 NA non-coding downstream 43859 7598193 ~ 7598590 (+)
G45132 NA non-coding downstream 44502 7598836 ~ 7599365 (+)
G45179 NA non-coding downstream 49351 7603685 ~ 7604821 (+)
G45178 NA non-coding downstream 53270 7607604 ~ 7683671 (+)
G44872 NA other upstream 166213 7356352 ~ 7387884 (+)
CI01000006_07167131_07168925 NA other upstream 383563 7166778 ~ 7168925 (+)
CI01000006_06122278_06122736 NA other upstream 1425422 6122035 ~ 6122751 (+)
CI01000006_06104927_06109730 NA other upstream 1444509 6104927 ~ 6109820 (+)
G43896 NA other upstream 1782322 5770089 ~ 5771775 (+)
G45265 NA other downstream 329533 7883867 ~ 7920355 (+)
G45336 NA other downstream 465008 8019342 ~ 8021951 (+)
CI01000006_08198328_08199463 NA other downstream 605182 8197881 ~ 8200145 (+)
G45355 NA other downstream 655221 8209555 ~ 8212388 (+)

Expression



Co-expression Network