G65246


Basic Information

Item Value
gene id G65246
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 7347194 ~ 7347481 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU74268
AGTTGTGTTGCTTAATATTTTATTGGAACCTGTGATACTTTTTTCAGGATTCATTGATGAATAAAAGGTTAAAAAGAACAGCATTTATTCAAAATATAAATCTTTTCTAACAATATAAATCTTGATTATCACTTTTTATCAATTTAACACATCCGTGCAATATAAAAGTATTAATTTCTTTCAAAAAAAAGAAAGAAAAAAAATTACTGACCCTAAAATTTTGAACGGTAGTGTATATTGTTGTAAAAGATTTCTATTTTAAATAAATGCTGATGTTTTTTAACTTTT

Function

NR:

description
PREDICTED: tubulin beta-3 chain

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU74268 True 288 lncRNA 0.23 1 7347194 7347481

Neighbor

gene id symbol gene type direction distance location
CI01000010_07342174_07344454 NA coding downstream 2149 7342174 ~ 7345045 (-)
CI01000010_07337002_07341920 NA coding downstream 5274 7336613 ~ 7341920 (-)
CI01000010_07320443_07334877 ATP2A2.S, ATP2A2B, ATP2A2A, ATP2A2 coding downstream 12201 7319816 ~ 7334993 (-)
CI01000010_07135276_07196633 NTNG2A, NTNG2 coding downstream 150561 7134391 ~ 7200800 (-)
CI01000010_07128701_07132022 ENDOG coding downstream 215126 7128662 ~ 7132068 (-)
CI01000010_07347866_07367517 IFT81 coding upstream 342 7347823 ~ 7367789 (-)
CI01000010_07409069_07441868 NA coding upstream 61016 7408497 ~ 7441868 (-)
CI01000010_07503276_07509080 NA coding upstream 155418 7502899 ~ 7509475 (-)
CI01000010_07528012_07533124 FXN coding upstream 180209 7527690 ~ 7533124 (-)
CI01000010_07758998_07771497 BRPF3, BRPF3B coding upstream 410941 7758422 ~ 7771822 (-)
G65238 NA non-coding downstream 526 7345614 ~ 7346668 (-)
G65364 NA non-coding downstream 72082 7274411 ~ 7275112 (-)
G65359 NA non-coding downstream 76611 7270219 ~ 7270583 (-)
G65336 NA non-coding downstream 79118 7237333 ~ 7268076 (-)
G65264 NA non-coding upstream 42479 7389960 ~ 7390629 (-)
G65248 NA non-coding upstream 100175 7447656 ~ 7454020 (-)
G65391 NA non-coding upstream 162753 7510234 ~ 7510746 (-)
G65427 NA non-coding upstream 281834 7629315 ~ 7630306 (-)
G65453 NA non-coding upstream 311954 7659435 ~ 7672343 (-)
G64918 NA other downstream 1250714 6093689 ~ 6096480 (-)
G64877 NA other downstream 1430183 5916257 ~ 5917011 (-)
G64564 NA other downstream 2104268 5049155 ~ 5242926 (-)
CI01000010_04612793_04613017 SMIM15 other downstream 2733638 4612460 ~ 4613135 (-)
G64237 NA other downstream 3110778 4229950 ~ 4236416 (-)
CI01000010_07880416_07900104 NA other upstream 495155 7880375 ~ 7900104 (-)
G67099 NA other upstream 1294209 8641690 ~ 8674897 (-)
CI01000010_11929215_11933223 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other upstream 4581480 11928448 ~ 11933343 (-)
CI01000010_11965317_11969111 NA other upstream 4617384 11964865 ~ 11969710 (-)

Expression


Co-expression Network