G70047


Basic Information

Item Value
gene id G70047
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 2503858 ~ 2504076 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU79870
TAAGTTAAAGAATAAAATACAATATATAATTATAATAACCGTTACATATTTACAGGAGGAAAACATATTTTCTCCGGGAGAGAGAGAAAAATGAAAAAATTAATAACCCGTTGATCTTTTGTGTGTGTGTTTTGTTACTATACATATCGAGACTGATGGTCTCGAAGGAAGCAAACTGTTTAGCATTTAAAAAAATACGAAACAAAAAGAAACAATAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU79870 True 219 lncRNA 0.28 1 2503858 2504076

Neighbor

gene id symbol gene type direction distance location
CI01000012_02389469_02394443 ST3GAL7 coding upstream 109182 2389343 ~ 2394676 (+)
CI01000012_02375605_02376849 MORN4 coding upstream 126079 2375605 ~ 2377779 (+)
CI01000012_02160248_02170508 NA coding upstream 332605 2160055 ~ 2171253 (+)
CI01000012_02010306_02155547 NA coding upstream 347972 2010047 ~ 2155886 (+)
CI01000012_01698932_01719811 NA coding upstream 783751 1697400 ~ 1720107 (+)
CI01000012_02507678_02521107 CNNM1 coding downstream 3602 2507678 ~ 2521107 (+)
CI01000012_02570663_02574866 NKX2.3 coding downstream 66587 2570663 ~ 2574892 (+)
CI01000012_02581291_02583307 NKX3.3 coding downstream 76453 2580529 ~ 2583477 (+)
CI01000012_02641833_02651606 PYROXD2 coding downstream 137757 2641833 ~ 2652145 (+)
CI01000012_02663225_02675005 NA coding downstream 159149 2663225 ~ 2675246 (+)
G69878 NA non-coding upstream 287848 2215773 ~ 2216010 (+)
G69801 NA non-coding upstream 639037 1864531 ~ 1864821 (+)
G69799 NA non-coding upstream 641873 1861646 ~ 1861985 (+)
G69796 NA non-coding upstream 649756 1853825 ~ 1854102 (+)
G69760 NA non-coding upstream 685587 1817858 ~ 1818271 (+)
G70050 NA non-coding downstream 2267 2506343 ~ 2506600 (+)
G70028 NA non-coding downstream 39194 2543270 ~ 2557138 (+)
G70059 NA non-coding downstream 68142 2572218 ~ 2572480 (+)
G70036 NA non-coding downstream 72004 2576080 ~ 2577048 (+)
G70061 NA non-coding downstream 83408 2587484 ~ 2587689 (+)
G68725 NA other upstream 1819002 683523 ~ 684856 (+)
G68660 NA other upstream 1967905 535566 ~ 535953 (+)
CI01000012_00194370_00195347 HCAR1-3 other upstream 2298084 193903 ~ 195676 (+)
G68282 NA other upstream 2443326 26390 ~ 60532 (+)
G70029 NA other downstream 118402 2622478 ~ 2631385 (+)
CI01000012_04424569_04425090 NA other downstream 1916163 4424569 ~ 4425756 (+)
CI01000012_04495631_04501066 NA other downstream 1994377 4495631 ~ 4501066 (+)
CI01000012_05177587_05180517 SRSF5A other downstream 2672819 5176895 ~ 5180970 (+)
G71199 NA other downstream 2909174 5413250 ~ 5416785 (+)

Expression


Co-expression Network