G87420


Basic Information

Item Value
gene id G87420
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000015
NCBI id null
chromosome length 8631711
location 1574489 ~ 1574765 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU99544
TTTTGTTGCTCTCAATAAGAGGGTTTACACCATAAGCAAGCACCGCAACATGATATGTTCCTTCATCTTCCAGTGAGAGATTTGTGATGTGTAGTGTGACAGTACTGTTTTCCACATCACTGAGTACAAACTTTTCTGAGCAAGAAGTATCTGTTTGTCTGCAATATCCTTTCTTGTTCCCATTATTGTACAGACTTGTACGTTTGTTGGGAAAACTGTTGATAACAGAATCTTGAAATGTGAATTCAACGGTGATGTTTTCTTCCACCGTACCATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU99544 True 277 lncRNA 0.38 1 1574489 1574765

Neighbor

gene id symbol gene type direction distance location
CI01000015_01412031_01434518 RUBCN coding upstream 139971 1412031 ~ 1434518 (+)
CI01000015_01405454_01407722 NA coding upstream 165754 1404981 ~ 1409173 (+)
CI01000015_01349369_01366864 ZNRF4, RNF13 coding upstream 206978 1349369 ~ 1367511 (+)
CI01000015_01307849_01327079 SRFA, SRF coding upstream 246113 1306824 ~ 1328376 (+)
CI01000015_01288157_01300925 NA coding upstream 273358 1288157 ~ 1301131 (+)
CI01000015_01580548_01582805 TCTEX1D2 coding downstream 5783 1580548 ~ 1583078 (+)
CI01000015_01638133_01646368 HYKK.2, HYKK coding downstream 60661 1635426 ~ 1646409 (+)
CI01000015_01688642_01691631 NA coding downstream 113877 1688642 ~ 1691941 (+)
CI01000015_02012379_02029276 EPHB3 coding downstream 437614 2012379 ~ 2029701 (+)
CI01000015_02268895_02277023 NA coding downstream 693850 2268615 ~ 2277083 (+)
G87416 NA non-coding upstream 2069 1569832 ~ 1572420 (+)
G87413 NA non-coding upstream 17663 1556442 ~ 1556826 (+)
G87385 NA non-coding upstream 76965 1497249 ~ 1497524 (+)
G87373 NA non-coding upstream 96529 1477369 ~ 1477960 (+)
G87372 NA non-coding upstream 99010 1475110 ~ 1475479 (+)
G87421 NA non-coding downstream 288 1575053 ~ 1575350 (+)
G87423 NA non-coding downstream 1435 1576200 ~ 1576487 (+)
G87425 NA non-coding downstream 4291 1579056 ~ 1579409 (+)
G87435 NA non-coding downstream 38897 1613662 ~ 1613940 (+)
G87442 NA non-coding downstream 71895 1646660 ~ 1648169 (+)
G87432 NA other downstream 36318 1611083 ~ 1611387 (+)
G87972 NA other downstream 301239 1876004 ~ 1876594 (+)
G88172 NA other downstream 809251 2384016 ~ 2526510 (+)
CI01000015_02512276_02523824 NA other downstream 937333 2511546 ~ 2524572 (+)
CI01000015_03011472_03026518 NA other downstream 1448231 3011472 ~ 3026636 (+)

Expression


Co-expression Network