G87432


Basic Information

Item Value
gene id G87432
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000015
NCBI id null
chromosome length 8631711
location 1611083 ~ 1611387 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU99556
ATGGCTTCTCTGGGCTCCCTCGTCCTTCCGGCTCTGCCTTGGTCAGCCGTCGACCTGCCTGTGGCTTTGGCTCCGTCTGGCTTTGCCTTCCCCCTGGCTCCGCCTCCATCCTCTGTCCCACTGGCTCAGCCTCTGTTCTCTGGTTATCCGGCTCCACCTCGGACACTCGTTGCCGCGGCTCCACCTCGGTCTCCAGTGCCATCGGTCTCGCGTGGGCTCATCGACCTGTAAACTCCACCAGTGTCTCCATCTTTGGTGGAGGTATATTCATCAGTCATCCCCAGTGTGCACTCCAAGTCGTTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU99556 True 305 TUCP 0.60 1 1611083 1611387

Neighbor

gene id symbol gene type direction distance location
CI01000015_01580548_01582805 TCTEX1D2 coding upstream 28005 1580548 ~ 1583078 (+)
CI01000015_01412031_01434518 RUBCN coding upstream 176565 1412031 ~ 1434518 (+)
CI01000015_01405454_01407722 NA coding upstream 202348 1404981 ~ 1409173 (+)
CI01000015_01349369_01366864 ZNRF4, RNF13 coding upstream 243572 1349369 ~ 1367511 (+)
CI01000015_01307849_01327079 SRFA, SRF coding upstream 282707 1306824 ~ 1328376 (+)
CI01000015_01638133_01646368 HYKK.2, HYKK coding downstream 24039 1635426 ~ 1646409 (+)
CI01000015_01688642_01691631 NA coding downstream 77255 1688642 ~ 1691941 (+)
CI01000015_02012379_02029276 EPHB3 coding downstream 400992 2012379 ~ 2029701 (+)
CI01000015_02268895_02277023 NA coding downstream 657228 2268615 ~ 2277083 (+)
CI01000015_02366085_02370003 NA coding downstream 754327 2365714 ~ 2370475 (+)
G87425 NA non-coding upstream 31674 1579056 ~ 1579409 (+)
G87423 NA non-coding upstream 34596 1576200 ~ 1576487 (+)
G87421 NA non-coding upstream 35733 1575053 ~ 1575350 (+)
G87420 NA non-coding upstream 36318 1574489 ~ 1574765 (+)
G87416 NA non-coding upstream 38663 1569832 ~ 1572420 (+)
G87435 NA non-coding downstream 2275 1613662 ~ 1613940 (+)
G87442 NA non-coding downstream 35273 1646660 ~ 1648169 (+)
G87459 NA non-coding downstream 52982 1664369 ~ 1664588 (+)
G87468 NA non-coding downstream 60851 1672238 ~ 1672461 (+)
G87487 NA non-coding downstream 98586 1709973 ~ 1710185 (+)
G87972 NA other downstream 264617 1876004 ~ 1876594 (+)
G88172 NA other downstream 772629 2384016 ~ 2526510 (+)
CI01000015_02512276_02523824 NA other downstream 900711 2511546 ~ 2524572 (+)
CI01000015_03011472_03026518 NA other downstream 1411609 3011472 ~ 3026636 (+)
G89822 NA other downstream 2680459 4291846 ~ 4314351 (+)

Expression


Co-expression Network