G107004


Basic Information

Item Value
gene id G107004
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 835671 ~ 836186 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU121665
CTACGCGGCTGGTCTTGTTTTGCTCTCGCGGTACTTTGATGGCACATGTGATCGTAAGGCGGCTGCAGCACTGATCAAAGTTGGACAAATGTTCTAACCAGAATGCATTGATTTTGCCAGGCGGCAGCTGAACCAGAGATCGTATTATTATGGGGAGATAAGAGGGTCTGTATCTCTTACCATTGGAGAAAGCATAACGGCTAACTTAATCACATGCGGCACCTCTCAGCCTATCGTGTCGCCGTTCAAAACTCCTTCCTGCGTACCGCCAATGCGTACCGCCAGTTAGCATTAGCCGTTACGCTTTTTTGGCTAAAGGTTGCAGGCTTGCCTTCCAGTGGCTTTGGCTGAACTTCGTGGCACTGCATGAAGTCGAACAAGCCTAAAAGCGGCTGCACGAGCACTGATGACGAAAGCTGTTCCATGATTGGCCGGATTCACGTATATTTACTCTCACACCTTCAGTTCCACTAATGCTCACAAATCTGTATAGATCCCACTTCATTGGTATTTAAA

Function

NR:

description
PREDICTED: endoplasmic reticulum-Golgi intermediate compartment protein 1 isoform X1

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU121665 True 516 lncRNA 0.48 1 835671 836186

Neighbor

gene id symbol gene type direction distance location
CI01000019_00809471_00828531 NA coding upstream 5929 808791 ~ 829742 (+)
CI01000019_00791525_00800217 NA coding upstream 35255 791219 ~ 800416 (+)
CI01000019_00786469_00789270 NA coding upstream 46102 786413 ~ 789650 (+)
CI01000019_00785792_00786324 NA coding upstream 49273 785792 ~ 786398 (+)
CI01000019_00750525_00759434 RYROXD1, PYROXD1 coding upstream 75827 750141 ~ 759844 (+)
CI01000019_00848936_00865021 NA coding downstream 11780 847966 ~ 865503 (+)
CI01000019_00871622_00875254 NA coding downstream 35436 869371 ~ 878017 (+)
CI01000019_01021871_01022293 NA coding downstream 184561 1020747 ~ 1022541 (+)
CI01000019_01025556_01025846 NA coding downstream 188188 1024374 ~ 1026077 (+)
CI01000019_01067005_01080043 B4GALNT3A coding downstream 230819 1067005 ~ 1081102 (+)
G107011 NA non-coding upstream 19508 789727 ~ 816163 (+)
G107066 NA non-coding upstream 53523 781673 ~ 782148 (+)
G107000 NA non-coding upstream 72545 762841 ~ 763126 (+)
G107062 NA non-coding upstream 86304 749067 ~ 749367 (+)
G107061 NA non-coding upstream 87474 747940 ~ 748197 (+)
G107114 NA non-coding downstream 71032 907218 ~ 908301 (+)
G107219 NA non-coding downstream 203006 1039192 ~ 1039416 (+)
G107239 NA non-coding downstream 264176 1100362 ~ 1100567 (+)
G107247 NA non-coding downstream 304256 1140442 ~ 1140901 (+)
G107312 NA other downstream 793246 1629432 ~ 1629985 (+)
G107310 NA other downstream 864559 1700745 ~ 1706990 (+)
G108050 NA other downstream 1504813 2340999 ~ 2341333 (+)
G108563 NA other downstream 2332162 3168348 ~ 3169195 (+)
G108454 NA other downstream 2376265 3212451 ~ 3234285 (+)

Expression


Co-expression Network