G131574


Basic Information

Item Value
gene id G131574
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 7725496 ~ 7726088 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU149662
TAATGAATGTTTGATATCTATGGATAGAACAGATGCTGGTTAAAAAATTGACATCAGTGAAAGTGGAAAAAAATATTAATAAATCATATTTCTATGACAGTTTTTTGGCATGGACATTTTTGTCCATTATGGACCTAAGTGTTAGTTTTTTTAAAAAAAATCTGACACTACATAAAAAATATAAATGCCTCAAAATTAATGTTGTTGTTCTTCATTGACCCACCCAAGAATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU149662 True 232 lncRNA 0.28 2 7725496 7726088

Neighbor

gene id symbol gene type direction distance location
CI01000026_07707119_07710156 CRYBGX coding downstream 14752 7707016 ~ 7710744 (-)
CI01000026_07681254_07684511 SMAD6A coding downstream 40985 7681026 ~ 7684511 (-)
CI01000026_07625890_07661161 SMAD3 coding downstream 63716 7624704 ~ 7661780 (-)
CI01000026_07537510_07596897 MAP2K5 coding downstream 128148 7537160 ~ 7597348 (-)
CI01000026_07519204_07523946 SKOR1A, SKOR1 coding downstream 201550 7519002 ~ 7523946 (-)
CI01000026_07738249_07739846 NA coding upstream 11754 7737842 ~ 7739888 (-)
CI01000026_07786816_07835100 MADD coding upstream 59071 7785159 ~ 7835100 (-)
CI01000026_07853925_07863410 NR1H3 coding upstream 127497 7853585 ~ 7863410 (-)
CI01000026_07876455_07881355 TEX9 coding upstream 150252 7876340 ~ 7882737 (-)
CI01000026_08150334_08189089 NA coding upstream 424246 8150334 ~ 8189089 (-)
G131571 NA non-coding downstream 10321 7714949 ~ 7715175 (-)
G131568 NA non-coding downstream 12756 7712523 ~ 7712740 (-)
G131516 NA non-coding downstream 194500 7528998 ~ 7530996 (-)
G131447 NA non-coding downstream 495369 7229880 ~ 7230127 (-)
G131444 NA non-coding downstream 500628 7224428 ~ 7224868 (-)
G131594 NA non-coding upstream 231683 7957771 ~ 7958806 (-)
G131680 NA non-coding upstream 292105 8018193 ~ 8032978 (-)
G131668 NA non-coding upstream 440752 8166840 ~ 8174432 (-)
G131673 NA non-coding upstream 468839 8194927 ~ 8204389 (-)
G130256 NA other downstream 1408342 6275511 ~ 6317154 (-)
G129750 NA other downstream 2906214 4785885 ~ 4820249 (-)
G129658 NA other downstream 3352427 4367296 ~ 4373069 (-)
G129476 NA other downstream 4054612 3670574 ~ 3670884 (-)
CI01000026_03439507_03490314 PDE3B other downstream 4234993 3438795 ~ 3490503 (-)
G131742 NA other upstream 580688 8306776 ~ 8307707 (-)
G132575 NA other upstream 1661063 9387151 ~ 9387716 (-)
G132721 NA other upstream 1823942 9550030 ~ 9550644 (-)
CI01000026_10347872_10351783 CEBPA other upstream 2622105 10347746 ~ 10351783 (-)
CI01000026_10788054_10788652 CD59 other upstream 3061251 10787339 ~ 10789709 (-)

Expression


Co-expression Network