G133514


Basic Information

Item Value
gene id G133514
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 11320865 ~ 11321130 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU151796
TCAGTTTGAATAGAGTCGCTCGGCGGTACCGATCTGAGTGACTGTATTTCATGAGCTGAAGTCTGGACGGCATGAAATGCAGAAAAAACCCAGGCTTTGCCAGGGACTCCAGCGAATCAAAGCCGGAGATCCAGGTGTCTCTATGAAGAACAAATGTAGCTGCATCCCAGAATGCCTCAGTCTCTTCCCACTTCTCCAGTCTCAGCTGGCCACTGCGCTCTGCTTTTAAGAAGTAGTTGGGTCTGTCTGCTGCCTCAAATGACACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU151796 True 266 lncRNA 0.50 1 11320865 11321130

Neighbor

gene id symbol gene type direction distance location
CI01000026_11298219_11305000 NA coding upstream 15852 11298219 ~ 11305013 (+)
CI01000026_11266022_11278889 NA coding upstream 41966 11266022 ~ 11278899 (+)
CI01000026_11262923_11264188 TNNI2A.4, TNNI2B.2, TNNI2B.1 coding upstream 56331 11261081 ~ 11264534 (+)
CI01000026_11241496_11246081 NA coding upstream 74784 11241496 ~ 11246204 (+)
CI01000026_11239339_11240254 TNNI2A.4, TNNI2B.2, TNNI2B.1 coding upstream 80432 11239339 ~ 11240433 (+)
CI01000026_11403059_11415298 PTPN5 coding downstream 81929 11403059 ~ 11415512 (+)
CI01000026_11436071_11446054 KIAA0232 coding downstream 114371 11435501 ~ 11446322 (+)
CI01000026_11456632_11473446 TBC1D14 coding downstream 135502 11456632 ~ 11473653 (+)
CI01000026_11483300_11485455 TADA2B coding downstream 162170 11483300 ~ 11486080 (+)
CI01000026_11497016_11677778 SORCS2 coding downstream 175886 11497016 ~ 11677778 (+)
G133501 NA non-coding upstream 64598 11256009 ~ 11256267 (+)
G133491 NA non-coding upstream 127040 11193361 ~ 11193825 (+)
G133454 NA non-coding upstream 167468 11144309 ~ 11153397 (+)
G133444 NA non-coding upstream 200115 11120509 ~ 11120750 (+)
G133443 NA non-coding upstream 200988 11119648 ~ 11119877 (+)
G133515 NA non-coding downstream 125 11321255 ~ 11321553 (+)
G133516 NA non-coding downstream 674 11321804 ~ 11324137 (+)
G133519 NA non-coding downstream 10936 11332066 ~ 11332275 (+)
G133520 NA non-coding downstream 12211 11333341 ~ 11333687 (+)
G133521 NA non-coding downstream 12743 11333873 ~ 11334103 (+)
CI01000026_11075931_11078249 MDK, MDKA other upstream 241785 11075784 ~ 11079080 (+)
G133192 NA other upstream 1158904 10159819 ~ 10161961 (+)
G132667 NA other upstream 1751705 9568739 ~ 9569160 (+)
G131077 NA other upstream 2814078 8501408 ~ 8506787 (+)
G133542 NA other downstream 154987 11476117 ~ 11477544 (+)

Expression


Co-expression Network