CI01000026_11239339_11240254 (TNNI2A.4, TNNI2B.2, TNNI2B.1)


Basic Information

Item Value
gene id CI01000026_11239339_11240254
gene name TNNI2A.4, TNNI2B.2, TNNI2B.1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 11239339 ~ 11240433 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000026_11239339_11240254.mRNA
ATGACCTCAAGCCGTCGGCATCATCTCAAGAGTTTGATACTGGGTATAGCCAAGGACCTGTTGGAGGCTGAGGAAAAGCAGAGAGAGGAAGACAGAATTCACTATATGGAGGAGAAATGTCCTCCTCTGTCTCTGCCTGGCTCTGTGCAGGAATTACAGGATCTGTGCAAACAGCTTCATCAGCAGATTGATGTGGTGGACGAGGAGAGATATGACATGTCTGTTAAAGTGGCCAAAAGTGACAAAGAGATTGAGGATCTGAAGATAAAAGTTCAAGACCTGAAAGGTAAATTCAAGAAACCTGCTCTGAAGAAAGTGCGTATGTCTGCTGATGCCATGCTGCAGGCCCTGCTGGGCTCCAAACACAAAGTGTCCATGGACCTGAGAGCCAACCTCAAACAGGTCAAGAAAGAGGTCAAGGAGGAGGATAAGGAGGCAGTGGGAGATTGGCGTAAGAACATCGAGGACAAGGCTGGTATGGGCGGCAGGAAGAAGATGTTTGAATCTGAGGCTTAAACAGGCAGCTATTTTACTTTTGGAGTTGATTTCTGATGGACTTTCTGCTGTCGTTGTTGCACATTTCACTGTCAAAAAAGTGCTTTCGCGTCCAAACTACACATCCAACAAGCCAACAGTAACTAAGCTAATCATAATATTCAGAATGTCATGTATTATACATGAGCTCACCTTAACAA

Function

symbol description
tnni2a.4 Acts upstream of or within myofibril assembly. Predicted to be part of troponin complex. Is expressed in musculature system and somite. Human ortholog(s) of this gene implicated in arthrogryposis multiplex congenita; distal arthrogryposis type 2B1; and intrinsic cardiomyopathy (multiple). Orthologous to several human genes including TNNI2 (troponin I2, fast skeletal type).
tnni2b.2 Predicted to be involved in cardiac muscle contraction and skeletal muscle contraction. Predicted to be part of troponin complex. Is expressed in adaxial cell; cephalic musculature; muscle; myotome; and somite. Human ortholog(s) of this gene implicated in arthrogryposis multiplex congenita; distal arthrogryposis type 2B1; and intrinsic cardiomyopathy (multiple). Orthologous to several human genes including TNNI2 (troponin I2, fast skeletal type).
tnni2b.1 Predicted to be involved in cardiac muscle contraction and skeletal muscle contraction. Predicted to be part of troponin complex. Human ortholog(s) of this gene implicated in arthrogryposis multiplex congenita; distal arthrogryposis type 2B1; and intrinsic cardiomyopathy (multiple). Orthologous to several human genes including TNNI2 (troponin I2, fast skeletal type).

NR:

description
Troponin I, skeletal, fast 2a.4

GO:

id name namespace
GO:0060048 cardiac muscle contraction biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000026_11239339_11240254.mRNA True 695 mRNA 0.45 5 11239339 11240433

Neighbor

gene id symbol gene type direction distance location
CI01000026_11203781_11212074 NA coding upstream 26757 11203781 ~ 11212582 (+)
CI01000026_11075931_11078249 MDK, MDKA coding upstream 160883 11075784 ~ 11079080 (+)
CI01000026_11032284_11063044 NA coding upstream 175714 11031679 ~ 11063625 (+)
CI01000026_11012960_11021926 NA coding upstream 217413 11011340 ~ 11021926 (+)
CI01000026_10955581_10955874 NA coding upstream 283426 10954814 ~ 10955913 (+)
CI01000026_11241496_11246081 NA coding downstream 1063 11241496 ~ 11246204 (+)
CI01000026_11262923_11264188 TNNI2A.4, TNNI2B.2, TNNI2B.1 coding downstream 20648 11261081 ~ 11264534 (+)
CI01000026_11266022_11278889 NA coding downstream 25589 11266022 ~ 11278899 (+)
CI01000026_11298219_11305000 NA coding downstream 57786 11298219 ~ 11305013 (+)
CI01000026_11403059_11415298 PTPN5 coding downstream 162626 11403059 ~ 11415512 (+)
G133491 NA non-coding upstream 45514 11193361 ~ 11193825 (+)
G133454 NA non-coding upstream 85942 11144309 ~ 11153397 (+)
G133444 NA non-coding upstream 118589 11120509 ~ 11120750 (+)
G133443 NA non-coding upstream 119462 11119648 ~ 11119877 (+)
G133442 NA non-coding upstream 120317 11118711 ~ 11119022 (+)
G133501 NA non-coding downstream 15576 11256009 ~ 11256267 (+)
G133514 NA non-coding downstream 80432 11320865 ~ 11321130 (+)
G133515 NA non-coding downstream 80822 11321255 ~ 11321553 (+)
G133516 NA non-coding downstream 81371 11321804 ~ 11324137 (+)
G133519 NA non-coding downstream 91633 11332066 ~ 11332275 (+)
G133192 NA other upstream 1077378 10159819 ~ 10161961 (+)
G132667 NA other upstream 1670179 9568739 ~ 9569160 (+)
G131077 NA other upstream 2732552 8501408 ~ 8506787 (+)
CI01000026_08297901_08307596 CTRB1 other upstream 2939925 8297857 ~ 8307629 (+)
G133542 NA other downstream 235684 11476117 ~ 11477544 (+)

Expression


Co-expression Network