G143038


Basic Information

Item Value
gene id G143038
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 9290413 ~ 9290643 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU162512
TACACACTTGCTTTTGTATGCAACAGAATATCTTAAATACACATTACCAGGCCATGTTCTAGTACAGGGGATATGGAGAACAATCATAAACATGATATAATTGTTTAAACACAAGATCTGAACATAAACTGTTCAGGCTGCCATCCTAATTCTTTGTTACTGTGAGAGTATTTAAATAATGCCTCTATCTCGCAGATAAAGGGTCTTTTCAGGCACACTGACAGATACAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU162512 True 231 lncRNA 0.36 1 9290413 9290643

Neighbor

gene id symbol gene type direction distance location
CI01000027_09243269_09246171 NA coding upstream 43498 9243148 ~ 9246915 (+)
CI01000027_09235085_09240022 NA coding upstream 50391 9235085 ~ 9240022 (+)
CI01000027_09220776_09224935 MLF2 coding upstream 65054 9220640 ~ 9225359 (+)
CI01000027_09203231_09208317 WNT4B coding upstream 82047 9203002 ~ 9208366 (+)
CI01000027_09136426_09140323 NA coding upstream 150090 9135436 ~ 9140323 (+)
CI01000027_09294505_09295818 RPS9.L, BRAFLDRAFT_126921, RPS9 coding downstream 3359 9294002 ~ 9295885 (+)
CI01000027_09308025_09316510 PHC1 coding downstream 17289 9307932 ~ 9316668 (+)
CI01000027_09349353_09352981 MBOAT7 coding downstream 58710 9349353 ~ 9353150 (+)
CI01000027_09354981_09368973 TMC4 coding downstream 64338 9354981 ~ 9369462 (+)
CI01000027_09369991_09372314 NA coding downstream 79348 9369991 ~ 9373307 (+)
G143037 NA non-coding upstream 534 9289638 ~ 9289879 (+)
G142941 NA non-coding upstream 7356 9282424 ~ 9283057 (+)
G142907 NA non-coding upstream 23590 9208587 ~ 9266823 (+)
G142929 NA non-coding upstream 111886 9178236 ~ 9178527 (+)
G142918 NA non-coding upstream 137638 9150921 ~ 9152775 (+)
G143039 NA non-coding downstream 600 9291243 ~ 9291520 (+)
G143040 NA non-coding downstream 1578 9292221 ~ 9292646 (+)
G143045 NA non-coding downstream 15311 9305954 ~ 9306160 (+)
CI01000027_09398846_09400911 NA non-coding downstream 23205 9398846 ~ 9401795 (+)
G143050 NA non-coding downstream 42058 9332701 ~ 9333879 (+)
CI01000027_08255251_08264629 NA other upstream 1029587 8255073 ~ 8264897 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other upstream 1258372 8025788 ~ 8032041 (+)
CI01000027_07947743_07951397 NA other upstream 1338471 7947657 ~ 7951942 (+)
CI01000027_07469157_07471720 NA other upstream 1818699 7468964 ~ 7471999 (+)
CI01000027_06951132_06956691 GLIPR2, GLIPR2L other upstream 2332646 6951132 ~ 6957767 (+)
G143033 NA other downstream 438172 9728815 ~ 9729551 (+)

Expression


Co-expression Network