G152201


Basic Information

Item Value
gene id G152201
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2114027 ~ 2114361 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU172876
GTTTTTAAAGATGATACACGAAGATCATAATCTTTATGTAAAATCAGTTTAAATTAATTCCGCATACTACATGCAAATGGGAAAATTCAATGCCTCCTATTCAAGAATTGCATTCGTAGACAAAACACAGTATACAGGCACAGACACTGCGTGCATAGAAACATAAATAATCATTCAAAATAAAATCAATCCAATTAAATTAAAGGGATGGATACTCCACCCAAAAAATGAAAATTCTGTATTTAATTTACCCTCATGTGATTCCAAACCTGTATGCATTTCTTTCTTCTGTGGAAGAGAAAAGAAGATATTTTGAAGAATGTTTGTAACCAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU172876 True 335 lncRNA 0.31 1 2114027 2114361

Neighbor

gene id symbol gene type direction distance location
CI01000029_02102219_02105661 ESCO2 coding upstream 8001 2102070 ~ 2106026 (+)
CI01000029_02069731_02079236 SCARA3 coding upstream 34771 2069293 ~ 2079256 (+)
CI01000029_02037027_02050337 REPS1 coding upstream 63617 2037027 ~ 2050410 (+)
CI01000029_01941376_01941659 NA coding upstream 171507 1941376 ~ 1942520 (+)
CI01000029_01894962_01930271 MSRA coding upstream 183756 1894962 ~ 1930271 (+)
CI01000029_02192568_02196383 HDDC2 coding downstream 77550 2191911 ~ 2196691 (+)
CI01000029_02343103_02352351 NA coding downstream 226588 2340949 ~ 2352782 (+)
CI01000029_02427134_02429596 NA coding downstream 311737 2426098 ~ 2430095 (+)
CI01000029_02432238_02441531 NA coding downstream 317877 2432238 ~ 2441589 (+)
CI01000029_02445216_02480549 NA coding downstream 330612 2444973 ~ 2480664 (+)
G152199 NA non-coding upstream 3995 2109593 ~ 2110032 (+)
G152136 NA non-coding upstream 14597 2098001 ~ 2099430 (+)
G152134 NA non-coding upstream 56861 2054416 ~ 2057166 (+)
G152093 NA non-coding upstream 142186 1880628 ~ 1971841 (+)
G152096 NA non-coding upstream 205024 1906510 ~ 1909003 (+)
G152203 NA non-coding downstream 3382 2117743 ~ 2117966 (+)
G152204 NA non-coding downstream 3887 2118248 ~ 2118606 (+)
G152222 NA non-coding downstream 36819 2151180 ~ 2197893 (+)
G152244 NA non-coding downstream 110483 2224844 ~ 2225066 (+)
G152245 NA non-coding downstream 111242 2225603 ~ 2227687 (+)
CI01000029_01526863_01527414 NA other upstream 586128 1526754 ~ 1527899 (+)
G151495 NA other upstream 1742105 366541 ~ 371922 (+)
G151415 NA other upstream 1888782 170521 ~ 225245 (+)
G152451 NA other downstream 647233 2761594 ~ 2762939 (+)
G153475 NA other downstream 1430764 3545125 ~ 3562004 (+)
G153790 NA other downstream 2619228 4733589 ~ 4740107 (+)
G154587 NA other downstream 3156659 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 3342880 5461497 ~ 5470346 (+)

Expression


Co-expression Network