G152203


Basic Information

Item Value
gene id G152203
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2117743 ~ 2117966 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU172878
AAAACTTTCTGTATAGTCAAACAAACTCCCCGAAAGGGATTGTATAATTTGCACACCAGCTTAAGCTCTATGGAACATGGAAGCATTATCTGAAGACACAGTCTGAGCTTCAAAACTTCCTGTTCACAATTTCAAAGGCTTAATATCAGTTCTGGCGATTCAAGGTCATTTGGATAACAACAAGCCATTGGAAAATCCTTGACAGCCACTATACAAGTACTGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU172878 True 224 lncRNA 0.39 1 2117743 2117966

Neighbor

gene id symbol gene type direction distance location
CI01000029_02102219_02105661 ESCO2 coding upstream 11717 2102070 ~ 2106026 (+)
CI01000029_02069731_02079236 SCARA3 coding upstream 38487 2069293 ~ 2079256 (+)
CI01000029_02037027_02050337 REPS1 coding upstream 67333 2037027 ~ 2050410 (+)
CI01000029_01941376_01941659 NA coding upstream 175223 1941376 ~ 1942520 (+)
CI01000029_01894962_01930271 MSRA coding upstream 187472 1894962 ~ 1930271 (+)
CI01000029_02192568_02196383 HDDC2 coding downstream 73945 2191911 ~ 2196691 (+)
CI01000029_02343103_02352351 NA coding downstream 222983 2340949 ~ 2352782 (+)
CI01000029_02427134_02429596 NA coding downstream 308132 2426098 ~ 2430095 (+)
CI01000029_02432238_02441531 NA coding downstream 314272 2432238 ~ 2441589 (+)
CI01000029_02445216_02480549 NA coding downstream 327007 2444973 ~ 2480664 (+)
G152201 NA non-coding upstream 3382 2114027 ~ 2114361 (+)
G152199 NA non-coding upstream 7711 2109593 ~ 2110032 (+)
G152136 NA non-coding upstream 18313 2098001 ~ 2099430 (+)
G152134 NA non-coding upstream 60577 2054416 ~ 2057166 (+)
G152093 NA non-coding upstream 145902 1880628 ~ 1971841 (+)
G152204 NA non-coding downstream 282 2118248 ~ 2118606 (+)
G152222 NA non-coding downstream 33214 2151180 ~ 2197893 (+)
G152244 NA non-coding downstream 106878 2224844 ~ 2225066 (+)
G152245 NA non-coding downstream 107637 2225603 ~ 2227687 (+)
G152262 NA non-coding downstream 131689 2249655 ~ 2249856 (+)
CI01000029_01526863_01527414 NA other upstream 589844 1526754 ~ 1527899 (+)
G151495 NA other upstream 1745821 366541 ~ 371922 (+)
G151415 NA other upstream 1892498 170521 ~ 225245 (+)
G152451 NA other downstream 643628 2761594 ~ 2762939 (+)
G153475 NA other downstream 1427159 3545125 ~ 3562004 (+)
G153790 NA other downstream 2615623 4733589 ~ 4740107 (+)
G154587 NA other downstream 3153054 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 3339275 5461497 ~ 5470346 (+)

Expression


Co-expression Network