G153163


Basic Information

Item Value
gene id G153163
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2447130 ~ 2447590 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU173948
GTGTGATCCGTAAATACATTCATTGGTGCTCAAATGAAGAGCAGAGCATGTTGGTGATTTTGTATAGAGAGTTGAGTAATATTTTTCATGACTGAAATTACATTTCTCTTTTCTAGTAATGCTTATAAAAGTGTTTTTGATATATTATTATGTTCATAAATTCCCATTACTGTATATTTACAGTACTATCAAATATGGTAAATAAGATTCACGATTGAAATGCCACATATAAAATGTGCATGTAGTTTATATATTTCACTATATTTAATAAATAAACATTTATAAGGTCACCTGTTGAATTGCAATTCAGTTAATTCCTCTTCTTGTCTTTCTAATTCAAATTCTTGCTTGCTGTGAACAATTAAATTCAAGCCATGGAGTCAGTTGCTAAAGGAAACAATTTGTTCTGCTATTTTTCTACTAAAGTTTTTACATTAAACATTTAATTTTTTTAATCCCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU173948 True 461 lncRNA 0.28 1 2447130 2447590

Neighbor

gene id symbol gene type direction distance location
CI01000029_02359382_02359992 NA coding downstream 87138 2359013 ~ 2359992 (-)
CI01000029_02254888_02257580 NA coding downstream 189550 2254877 ~ 2257580 (-)
CI01000029_02231187_02248416 NA coding downstream 197639 2231187 ~ 2249491 (-)
CI01000029_02203122_02221481 TPD52L1 coding downstream 225649 2202780 ~ 2221481 (-)
CI01000029_02159023_02164894 NA coding downstream 282002 2158837 ~ 2165128 (-)
CI01000029_02502175_02516608 CLVS2 coding upstream 54566 2502156 ~ 2517380 (-)
CI01000029_02532272_02537205 SMPDL3A coding upstream 84610 2532200 ~ 2537205 (-)
CI01000029_02539755_02540836 FABP7B, FABP7 coding upstream 92139 2539729 ~ 2542444 (-)
CI01000029_02589994_02592379 NA coding upstream 140860 2587549 ~ 2592379 (-)
CI01000029_02593889_02603627 HSF2 coding upstream 145801 2593391 ~ 2603627 (-)
G153162 NA non-coding downstream 1240 2445151 ~ 2445890 (-)
G153161 NA non-coding downstream 3048 2443663 ~ 2444082 (-)
G153134 NA non-coding downstream 219567 2225717 ~ 2227563 (-)
G152762 NA non-coding downstream 332821 2113424 ~ 2114309 (-)
G153105 NA non-coding downstream 351048 2095835 ~ 2096082 (-)
G153164 NA non-coding upstream 25 2447615 ~ 2447842 (-)
G153165 NA non-coding upstream 947 2448537 ~ 2448867 (-)
G153166 NA non-coding upstream 3364 2450954 ~ 2451466 (-)
G153124 NA non-coding upstream 42650 2490240 ~ 2491346 (-)
CI01000029_01293143_01293964 BATF3 other downstream 1153007 1292249 ~ 1294123 (-)
G153891 NA other upstream 801187 3248777 ~ 3286554 (-)
CI01000029_03698769_03707177 NA other upstream 1258633 3698572 ~ 3707883 (-)
CI01000029_04460778_04463540 FKBP1B other upstream 2012753 4460159 ~ 4463540 (-)
G154415 NA other upstream 2538518 4986108 ~ 4990990 (-)

Expression


Co-expression Network