G153164


Basic Information

Item Value
gene id G153164
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2447615 ~ 2447842 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU173949
AAAAAGGGCATGCCAACATCAATACACACACACACACACCCATACACAGAAGTGTTTTCTTACAATCTTTGTCTTTCACACTTTTTTACACATTTAATTTGCATGCGATCAACAGGCTTGAATCTAAATTATTCGGCATGCGAAGCCACCTTTATGCCTGGTGATGCATTTACATGTGTGCAATTAGAATGATTAATTAATCAGCTTGTTTGTCTGCCGAGCGAATTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU173949 True 228 lncRNA 0.38 1 2447615 2447842

Neighbor

gene id symbol gene type direction distance location
CI01000029_02359382_02359992 NA coding downstream 87623 2359013 ~ 2359992 (-)
CI01000029_02254888_02257580 NA coding downstream 190035 2254877 ~ 2257580 (-)
CI01000029_02231187_02248416 NA coding downstream 198124 2231187 ~ 2249491 (-)
CI01000029_02203122_02221481 TPD52L1 coding downstream 226134 2202780 ~ 2221481 (-)
CI01000029_02159023_02164894 NA coding downstream 282487 2158837 ~ 2165128 (-)
CI01000029_02502175_02516608 CLVS2 coding upstream 54314 2502156 ~ 2517380 (-)
CI01000029_02532272_02537205 SMPDL3A coding upstream 84358 2532200 ~ 2537205 (-)
CI01000029_02539755_02540836 FABP7B, FABP7 coding upstream 91887 2539729 ~ 2542444 (-)
CI01000029_02589994_02592379 NA coding upstream 140608 2587549 ~ 2592379 (-)
CI01000029_02593889_02603627 HSF2 coding upstream 145549 2593391 ~ 2603627 (-)
G153163 NA non-coding downstream 25 2447130 ~ 2447590 (-)
G153162 NA non-coding downstream 1725 2445151 ~ 2445890 (-)
G153161 NA non-coding downstream 3533 2443663 ~ 2444082 (-)
G153134 NA non-coding downstream 220052 2225717 ~ 2227563 (-)
G152762 NA non-coding downstream 333306 2113424 ~ 2114309 (-)
G153165 NA non-coding upstream 695 2448537 ~ 2448867 (-)
G153166 NA non-coding upstream 3112 2450954 ~ 2451466 (-)
G153124 NA non-coding upstream 42398 2490240 ~ 2491346 (-)
CI01000029_01293143_01293964 BATF3 other downstream 1153492 1292249 ~ 1294123 (-)
G153891 NA other upstream 800935 3248777 ~ 3286554 (-)
CI01000029_03698769_03707177 NA other upstream 1258381 3698572 ~ 3707883 (-)
CI01000029_04460778_04463540 FKBP1B other upstream 2012501 4460159 ~ 4463540 (-)
G154415 NA other upstream 2538266 4986108 ~ 4990990 (-)

Expression


Co-expression Network