G154152



Basic Information


Item Value
gene id G154152
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 4075888 ~ 4076115 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU175040
CATTATTGCTTATCCACCTTATTTTGCAACACGGAAATAAGCTGTTTTCTGTGAATGTATGAGACTTCCATAAATAATTAGAAGAATTACTATTTGCACTACAAACCAGTGTGTTTATAATTACGATAATAAGTATTAAAATAATATAGCAAACACCAGTTTGCAATATCAAGCATGTTTTTGTACAGGTCAAATAACTGTAAGTGGATGCCTGCTCTTAGGTTAAAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU175040 True 228 lncRNA 0.31 1 4075888 4076115

Neighbor


gene id symbol gene type direction distance location
CI01000029_04071708_04075046 NA coding downstream 589 4070724 ~ 4075299 (-)
CI01000029_04046704_04057783 NA coding downstream 17632 4046646 ~ 4058256 (-)
CI01000029_04017725_04032225 EFR3BB, CCL33.2, EFR3B coding downstream 43663 4017193 ~ 4032225 (-)
CI01000029_03988871_03998768 NA coding downstream 77120 3988590 ~ 3998768 (-)
CI01000029_03949550_03958610 NA coding downstream 117144 3949306 ~ 3958744 (-)
CI01000029_04108560_04110587 MIXL1 coding upstream 32283 4108398 ~ 4110871 (-)
CI01000029_04115189_04121331 NA coding upstream 39048 4115163 ~ 4121331 (-)
CI01000029_04122433_04123725 TTC32 coding upstream 46093 4122208 ~ 4123725 (-)
CI01000029_04125071_04135324 MATN3, MATN3A coding upstream 48626 4124741 ~ 4135374 (-)
CI01000029_04138798_04141675 LAPTM4A, LAP4A coding upstream 62683 4138798 ~ 4141675 (-)
G154148 NA non-coding downstream 5447 4069253 ~ 4070441 (-)
G154147 NA non-coding downstream 7066 4068588 ~ 4068822 (-)
G154146 NA non-coding downstream 11038 4064572 ~ 4064850 (-)
G154144 NA non-coding downstream 13466 4062182 ~ 4062422 (-)
G154154 NA non-coding upstream 22855 4098970 ~ 4101128 (-)
G154169 NA non-coding upstream 159661 4235776 ~ 4236640 (-)
G154170 NA non-coding upstream 160647 4236762 ~ 4237074 (-)
G154171 NA non-coding upstream 163092 4239207 ~ 4239437 (-)
G154172 NA non-coding upstream 165590 4241705 ~ 4241998 (-)
CI01000029_03698769_03707177 NA other downstream 368636 3698572 ~ 3707883 (-)
G153891 NA other downstream 789334 3248777 ~ 3286554 (-)
CI01000029_02589994_02592379 NA other downstream 1483086 2587549 ~ 2592379 (-)
CI01000029_01293143_01293964 BATF3 other downstream 2781765 1292249 ~ 1294123 (-)
CI01000029_04460778_04463540 FKBP1B other upstream 384228 4460159 ~ 4463540 (-)
G154415 NA other upstream 909993 4986108 ~ 4990990 (-)
G156542 NA other upstream 3094252 7170367 ~ 7170951 (-)
G156495 NA other upstream 3290212 7365007 ~ 7371921 (-)

Expression



Co-expression Network