G163082


Basic Information

Item Value
gene id G163082
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 6988431 ~ 6988819 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU185241
AGAGTTGCAGTAGATTCATCCTAAATGTTGTGTGGAGGGAAGCAGATTCATATTGAGGTGTTTTAATCACAACAACATGAAGATCATTCAGCTTCAGCTCTATGTCTTAATCTGTTGTCAAGCAGCAGTAGCAGATCAACTAACTGATTTGGGATCAAATGTGACCATAAACTGCGATCTTGATGAAAATGAGGTTTATTGGATTTTACTGAAAACACCAGATCCTCCAACAGTGATTCTACGATCATTACCAACACCACGATCACCTTTTTACTTAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU185241 True 280 lncRNA 0.38 2 6988431 6988819

Neighbor

gene id symbol gene type direction distance location
CI01000030_06985089_06988057 NA coding downstream 327 6984257 ~ 6988104 (-)
CI01000030_06940324_06983295 NA coding downstream 4468 6940224 ~ 6983963 (-)
CI01000030_06919935_06930161 NA coding downstream 58103 6919413 ~ 6930328 (-)
CI01000030_06886173_06894325 NA coding downstream 94002 6886157 ~ 6894429 (-)
CI01000030_06841490_06848643 NA coding downstream 139772 6841072 ~ 6848659 (-)
CI01000030_07002565_07003644 NA coding upstream 13416 7002235 ~ 7003945 (-)
CI01000030_07008035_07011384 NA coding upstream 19014 7007833 ~ 7011384 (-)
CI01000030_07072355_07077515 RASM, MGC80266, MRAS coding upstream 83062 7071881 ~ 7077515 (-)
CI01000030_07118097_07122890 KRT97, KRT96 coding upstream 129278 7118097 ~ 7122980 (-)
CI01000030_07154555_07155973 NA coding upstream 165736 7154555 ~ 7155973 (-)
G163077 NA non-coding downstream 18779 6969403 ~ 6969652 (-)
G163078 NA non-coding downstream 19161 6969015 ~ 6969270 (-)
G163076 NA non-coding downstream 19988 6968073 ~ 6968443 (-)
G163030 NA non-coding downstream 25766 6962420 ~ 6962665 (-)
G163083 NA non-coding upstream 197 6989016 ~ 6989257 (-)
G163085 NA non-coding upstream 2828 6991647 ~ 6992035 (-)
G163099 NA non-coding upstream 25683 7014502 ~ 7014724 (-)
G163102 NA non-coding upstream 31184 7020003 ~ 7020262 (-)
G163103 NA non-coding upstream 31544 7020363 ~ 7020637 (-)
G163065 NA other downstream 62774 6924483 ~ 6925657 (-)
CI01000030_06747047_06752255 NA other downstream 236020 6746960 ~ 6752411 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other downstream 283686 6701055 ~ 6704745 (-)
CI01000030_06131710_06138371 NA other downstream 850025 6131090 ~ 6138406 (-)
G160949 NA other downstream 1188005 5797297 ~ 5800426 (-)
G163139 NA other upstream 160655 7149474 ~ 7150144 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other upstream 746617 7735436 ~ 7737720 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other upstream 799978 7788797 ~ 7792198 (-)
CI01000030_08185866_08194632 NA other upstream 1203100 8184897 ~ 8197266 (-)
G163873 NA other upstream 1944594 8933413 ~ 8933982 (-)

Expression


Co-expression Network