G163449


Basic Information

Item Value
gene id G163449
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 7845020 ~ 7845475 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU185698
GAAAAATTAATGTTAATAAATAAAGAGTCAAGAGCCCAACTAAAGGAAATGCTTTTCACCATCATGGTGACTTCAAACTAAACTTTCATTAAAACATTAACATCTAAACATCTGTTAATTCTCAATAAGAACTTTTGTTGATGTATTACAGAAATAAAATCAAGCTGGTTAATAATAAGTGTAATAATGTTTAATGGCTGGAAGTCAGTTGTAGTTGTCCTGTCTCTCTCTTTTTCTCTTGTTGTTTCTTCAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU185698 True 254 lncRNA 0.30 2 7845020 7845475

Neighbor

gene id symbol gene type direction distance location
CI01000030_07810359_07822361 RAD54L2 coding downstream 22659 7810359 ~ 7822361 (-)
CI01000030_07802211_07804196 NA coding downstream 40797 7802049 ~ 7804223 (-)
CI01000030_07794056_07801708 RASSF1 coding downstream 43312 7793671 ~ 7801708 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 coding downstream 52822 7788797 ~ 7792198 (-)
CI01000030_07769918_07776928 HYAL2B coding downstream 68092 7768948 ~ 7776928 (-)
CI01000030_07889005_07897250 ATRIP coding upstream 42856 7888331 ~ 7897250 (-)
CI01000030_07901178_07901441 NA coding upstream 55115 7900590 ~ 7901441 (-)
CI01000030_07915089_07922551 NA coding upstream 69544 7915019 ~ 7922704 (-)
CI01000030_07957599_07964510 NA coding upstream 111848 7957323 ~ 7964510 (-)
CI01000030_07987094_07988489 NA coding upstream 141305 7986780 ~ 7988681 (-)
G163448 NA non-coding downstream 752 7843812 ~ 7844268 (-)
G163445 NA non-coding downstream 14413 7829691 ~ 7830607 (-)
G163439 NA non-coding downstream 63468 7781244 ~ 7781552 (-)
G163435 NA non-coding downstream 117617 7727193 ~ 7727403 (-)
G163451 NA non-coding upstream 3786 7849261 ~ 7849617 (-)
G163453 NA non-coding upstream 5483 7850958 ~ 7851172 (-)
G163457 NA non-coding upstream 7311 7852786 ~ 7853160 (-)
G163459 NA non-coding upstream 10152 7855627 ~ 7857940 (-)
G163463 NA non-coding upstream 14438 7859913 ~ 7861688 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other downstream 107016 7735436 ~ 7737720 (-)
G163139 NA other downstream 694876 7149474 ~ 7150144 (-)
G163065 NA other downstream 919363 6924483 ~ 6925657 (-)
CI01000030_06747047_06752255 NA other downstream 1092609 6746960 ~ 6752411 (-)
CI01000030_08185866_08194632 NA other upstream 346444 8184897 ~ 8197266 (-)
G163873 NA other upstream 1087938 8933413 ~ 8933982 (-)
CI01000030_09277337_09294501 NA other upstream 1441731 9276431 ~ 9294802 (-)
G164071 NA other upstream 1629713 9475188 ~ 9476264 (-)
CI01000030_10103451_10131419 NA other upstream 2270040 10102944 ~ 10133765 (-)

Expression


Co-expression Network