G164042


Basic Information

Item Value
gene id G164042
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 9404246 ~ 9404459 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU186352
CTTAATTTCAAAGATTTACAAATGCAAAATGCAAAGAAATAGTTCAGAAATACTTTGCTAGTAACTATAAACAACAACCAAAGCAATATAAATTAATTAGTAAAAAAGATACTAATCTAAATGTCCTATATTTAAAAATGTCAACATGTTGAAAATATGCAGGTTAAAGGATTAGTGCACTTTAAAATGAAAATTACCCCAAGAAGTATTCGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU186352 True 214 lncRNA 0.26 1 9404246 9404459

Neighbor

gene id symbol gene type direction distance location
CI01000030_09277337_09294501 NA coding downstream 109444 9276431 ~ 9294802 (-)
CI01000030_09253701_09256358 NA coding downstream 146456 9252115 ~ 9257790 (-)
CI01000030_09225959_09236989 NA coding downstream 164964 9225332 ~ 9239282 (-)
CI01000030_09176691_09178066 NA coding downstream 226180 9176645 ~ 9178066 (-)
CI01000030_09038299_09059689 NA coding downstream 344226 9038248 ~ 9060020 (-)
CI01000030_09433282_09440636 NA coding upstream 28457 9432916 ~ 9441088 (-)
CI01000030_09448873_09453673 NA coding upstream 44313 9448772 ~ 9454092 (-)
CI01000030_09500443_09502785 NA coding upstream 95804 9500263 ~ 9502862 (-)
CI01000030_09561245_09573575 NA coding upstream 156703 9561162 ~ 9574107 (-)
CI01000030_09579086_09594020 NA coding upstream 174605 9579064 ~ 9594113 (-)
G164035 NA non-coding downstream 43159 9360803 ~ 9361087 (-)
G164034 NA non-coding downstream 43515 9360435 ~ 9360731 (-)
G163778 NA non-coding downstream 47274 9356535 ~ 9356972 (-)
G164027 NA non-coding downstream 59969 9343934 ~ 9344277 (-)
G164024 NA non-coding downstream 63728 9340317 ~ 9340518 (-)
G164053 NA non-coding upstream 38126 9442585 ~ 9443020 (-)
G164072 NA non-coding upstream 82007 9486466 ~ 9487179 (-)
G164074 NA non-coding upstream 88867 9493326 ~ 9493603 (-)
G164076 NA non-coding upstream 94958 9499417 ~ 9499873 (-)
G164084 NA non-coding upstream 113080 9517539 ~ 9539196 (-)
G163873 NA other downstream 470264 8933413 ~ 8933982 (-)
CI01000030_08185866_08194632 NA other downstream 1211760 8184897 ~ 8197266 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other downstream 1611864 7788797 ~ 7792198 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other downstream 1666242 7735436 ~ 7737720 (-)
G164071 NA other upstream 70729 9475188 ~ 9476264 (-)
CI01000030_10103451_10131419 NA other upstream 711056 10102944 ~ 10133765 (-)
CI01000030_10343879_10366274 NA other upstream 960958 10343865 ~ 10366508 (-)

Expression


Co-expression Network