G174090



Basic Information


Item Value
gene id G174090
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000036
NCBI id null
chromosome length 2115676
location 1496819 ~ 1497055 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU197727
CATACCCGCGTTACCCTCAGTTTCCGGTTTTATTTTGTAGAAACCATGGAAACACCAAAGACGCTTTAATATTTACATGTTTTAATAGACAAGGGAACAACTGTTTTGATATATTTATAGACAGAAAAACTAATTATTGTTATATAGCTCAACACGTTTAGTCTTATTGTTTAAATCTAATTTTCTTGATTTTTTGCGAGTACCATGCTTTACCATGCCTCAGAGAAAAACACTATT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU197727 True 237 lncRNA 0.32 1 1496819 1497055

Neighbor


gene id symbol gene type direction distance location
CI01000036_01475403_01476425 NA coding downstream 20128 1475403 ~ 1476691 (-)
CI01000036_01466321_01474630 NA coding downstream 22189 1465479 ~ 1474630 (-)
CI01000036_01428324_01454913 ITGAV coding downstream 41034 1428287 ~ 1455785 (-)
CI01000036_01417031_01422737 UMPS coding downstream 74082 1416887 ~ 1422737 (-)
CI01000036_01406109_01409167 CRYBA2B, CRYBA2, CRYBA2A coding downstream 87353 1406051 ~ 1409466 (-)
CI01000036_01611248_01620780 ZNF804A coding upstream 114064 1611119 ~ 1621389 (-)
CI01000036_01763171_01765280 NA coding upstream 265420 1762475 ~ 1765385 (-)
CI01000036_01782319_01786637 NUP35 coding upstream 284906 1781961 ~ 1786637 (-)
CI01000036_01839255_01848818 CUNH3ORF70 coding upstream 340094 1837149 ~ 1848818 (-)
CI01000036_01850532_01860056 EHHADH coding upstream 353406 1850461 ~ 1860056 (-)
G174084 NA non-coding downstream 7282 1489074 ~ 1489537 (-)
G174028 NA non-coding downstream 168154 1328395 ~ 1328665 (-)
G174025 NA non-coding downstream 173982 1322626 ~ 1322837 (-)
G174014 NA non-coding downstream 194507 1301935 ~ 1302312 (-)
G173998 NA non-coding downstream 229133 1267166 ~ 1267686 (-)
G174092 NA non-coding upstream 6236 1503291 ~ 1503644 (-)
G174100 NA non-coding upstream 18853 1515908 ~ 1516157 (-)
G174102 NA non-coding upstream 19996 1517051 ~ 1517420 (-)
G174121 NA non-coding upstream 58287 1555342 ~ 1555619 (-)
G174357 NA non-coding upstream 105476 1602531 ~ 1602885 (-)
G174002 NA other downstream 221624 1274778 ~ 1275195 (-)
G173528 NA other downstream 536442 959421 ~ 960377 (-)
G174386 NA other upstream 367879 1864934 ~ 2010840 (-)
CI01000036_02022324_02026053 NA other upstream 528853 2021947 ~ 2031983 (-)

Expression



Co-expression Network