G179963


Basic Information

Item Value
gene id G179963
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 3517188 ~ 3518417 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204332
TGAAATATTATAATTATAACTTCACAAAAGTACTTTTCTGATGTTTAAATGTGTAAACTTTTCATATAAATTGCAGTATGTTCATGGATTTCAAAAGGAAATCGAATTCACATTGATGTTGATTGAGAAGTTATTTCTGCGAACTCTGTGTTTTTTTTGTTGCCCGATTCCATCCGGTGACCTGATCAACTGTGAGCTTATGTGAGCTATGGCGAGCCAGACCCTGTGATTCTGTGAAGGCCTTACTGTTGACGTTCAACTCGAACCTGTCTTCATCGAGGGATTCTTTCCAATTACAGCTAAGCTGTCATTTTACACACACTACCCGGGTAGTAGGGAAAAGAAGGCCTTATACATACATTCGTTTTATACCACTCACCAACTTGCGAAGGAACCAGGAGGACTTTTGGACATTTCCTTTTCTTTACTTCTTTATTTTCTTCTTTCTCGGACCTTTTATGCACAACCTGGACTAAATATCGAATTTTTCCCATTCCAGCAGTGTTGTGTTGGGACGATACAGCAAAGTATTAACTTGTTTCTTCTATTATCATTTTTTTTTCTGTTTATATGTGCAATAAATGTGCTGGCTGTTACCTGCTTCATACCATTTGGCCCAAATTTCATTTTTATCCTCCCAAGAGTCGAACCTAGCCCTATACCTATTCAGAGTAATATAACATAGTGTTATACTGACAATTGTTGCCGTGTTACACA

Function

NR:

description
PREDICTED: tripartite motif-containing protein 16-like protein

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204332 True 717 lncRNA 0.37 2 3517188 3518417

Neighbor

gene id symbol gene type direction distance location
CI01000039_03454189_03458136 NA coding upstream 59048 3454040 ~ 3458140 (+)
CI01000039_03359162_03369982 NA coding upstream 146785 3358895 ~ 3370403 (+)
CI01000039_03352914_03354134 GAS1A coding upstream 162712 3351530 ~ 3354476 (+)
CI01000039_03181221_03188468 FBP2 coding upstream 327953 3180393 ~ 3189235 (+)
CI01000039_03170952_03179241 FBP1.S, F16P1, FBP1B, FBP1, FBP2, FBP1A coding upstream 337915 3169850 ~ 3179273 (+)
CI01000039_03596770_03597721 NA coding downstream 77580 3595997 ~ 3597726 (+)
CI01000039_03651436_03658228 NA coding downstream 133019 3651436 ~ 3658264 (+)
CI01000039_03659569_03662364 NA coding downstream 141152 3659569 ~ 3662652 (+)
CI01000039_03665710_03683733 NA coding downstream 146830 3665247 ~ 3683850 (+)
CI01000039_03684191_03691901 MCCC2, MCCC2.S coding downstream 165774 3684191 ~ 3691932 (+)
G179959 NA non-coding upstream 28823 3488048 ~ 3488365 (+)
G179951 NA non-coding upstream 55792 3460590 ~ 3461396 (+)
G179899 NA non-coding upstream 103012 3411792 ~ 3414176 (+)
G179901 NA non-coding upstream 105757 3411007 ~ 3411431 (+)
G179900 NA non-coding upstream 106790 3409291 ~ 3410398 (+)
G179966 NA non-coding downstream 6671 3525088 ~ 3529519 (+)
G179968 NA non-coding downstream 16209 3534626 ~ 3535176 (+)
G180008 NA non-coding downstream 76210 3594627 ~ 3595520 (+)
G180018 NA non-coding downstream 108779 3627196 ~ 3627505 (+)
G180026 NA non-coding downstream 184978 3703395 ~ 3703604 (+)
G179903 NA other upstream 91633 3424037 ~ 3425555 (+)
G179798 NA other upstream 385004 3129572 ~ 3132184 (+)
G179528 NA other upstream 1018569 2497674 ~ 2498619 (+)
G178423 NA other upstream 2531436 966676 ~ 982406 (+)
CI01000039_04048342_04049635 NA other downstream 529876 4048079 ~ 4049972 (+)
G180149 NA other downstream 556459 4079419 ~ 4079563 (+)
G180156 NA other downstream 572581 4090998 ~ 4091608 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other downstream 705162 4223868 ~ 4224657 (+)
CI01000039_04829464_04847182 ZFR other downstream 1325765 4829413 ~ 4848563 (+)

Expression


Co-expression Network