G180180


Basic Information

Item Value
gene id G180180
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 4222478 ~ 4222726 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204597
GCTGATATCAGAGTTTGTAGGGAAACTCCTACTGTCTGTCACCGTGTTGGACTGCGCCTCCAGCAGCACGACTTTAACTGATGTGGTGCCCAGATCCATGCCGAGAACAAAGTCGGCAGAACAACTGAGTGATGTCGCCATTACCTCTAAAGAAATCACTACTTTTGTGCAGTCAGAGCAAAATGTGCAGTATATGTCATTGCACACGAAAATAAACTGCTCTCTAGTTGTCCACGACAAGATCTAGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204597 True 249 lncRNA 0.47 1 4222478 4222726

Neighbor

gene id symbol gene type direction distance location
CI01000039_04198172_04200073 FAM222BA coding upstream 22318 4197246 ~ 4200160 (+)
CI01000039_04108687_04120437 FLOT2A, FLT2, FLOT2B, FLOT2 coding upstream 102041 4108687 ~ 4120437 (+)
CI01000039_04078795_04079273 NA coding upstream 143205 4078745 ~ 4079273 (+)
CI01000039_04070151_04075216 NA coding upstream 147117 4070098 ~ 4075361 (+)
CI01000039_04065787_04066284 NA coding upstream 155847 4065669 ~ 4066653 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L coding downstream 1162 4223868 ~ 4224657 (+)
CI01000039_04244908_04247540 CENPV coding downstream 21778 4244504 ~ 4247540 (+)
CI01000039_04295776_04307914 NCOR1 coding downstream 73050 4295776 ~ 4307914 (+)
CI01000039_04364813_04366029 NA coding downstream 141443 4364169 ~ 4366231 (+)
CI01000039_04370566_04373090 NA coding downstream 146901 4369627 ~ 4373462 (+)
G180191 NA non-coding upstream 2631 4219148 ~ 4219847 (+)
G180183 NA non-coding upstream 6292 4215970 ~ 4216186 (+)
G180173 NA non-coding upstream 6900 4214958 ~ 4215578 (+)
G180165 NA non-coding upstream 87106 4134383 ~ 4135372 (+)
G180188 NA non-coding upstream 88464 4133761 ~ 4134014 (+)
G180195 NA non-coding downstream 16554 4239280 ~ 4239507 (+)
G180161 NA non-coding downstream 17587 4240313 ~ 4242363 (+)
G180196 NA non-coding downstream 21513 4244239 ~ 4244503 (+)
G180166 NA non-coding downstream 26748 4249474 ~ 4252262 (+)
G180210 NA non-coding downstream 184297 4407023 ~ 4407280 (+)
G180156 NA other upstream 130870 4090998 ~ 4091608 (+)
G180149 NA other upstream 142915 4079419 ~ 4079563 (+)
CI01000039_04048342_04049635 NA other upstream 172506 4048079 ~ 4049972 (+)
G179903 NA other upstream 796923 3424037 ~ 3425555 (+)
G179798 NA other upstream 1090294 3129572 ~ 3132184 (+)
CI01000039_04829464_04847182 ZFR other downstream 621456 4829413 ~ 4848563 (+)
CI01000039_07324920_07329407 NA other downstream 3097958 7324596 ~ 7329472 (+)
CI01000039_07898330_07904918 DPF2 other downstream 3673150 7896773 ~ 7905162 (+)

Expression


Co-expression Network