G186057


Basic Information

Item Value
gene id G186057
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 4240066 ~ 4240279 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU211304
CAAGAACTTGTAGGAAAGTAAGGTCAGTTTTGATTTTATATTGACTTAAAATCATATTTATAATTTTGTCTCATACTGTAGCATATGGAGAGAGAGTTCATATAAATGCACACAAACTCACACACCATCTTGACGCATGAATAACTCGATCCTTCAGAATGAGAACTCTGGTTCCAAACCAGACATGCTGCTGAAACTGTCTCCACTTGAGCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU211304 True 214 lncRNA 0.37 1 4240066 4240279

Neighbor

gene id symbol gene type direction distance location
CI01000040_04063098_04068134 PPP2R2B coding upstream 171868 4062947 ~ 4068198 (+)
CI01000040_04047210_04060876 NA coding upstream 178391 4047210 ~ 4061675 (+)
CI01000040_03939728_03943493 RNF121 coding upstream 296442 3938308 ~ 3943624 (+)
CI01000040_03789687_03800746 STC2B coding upstream 439320 3789081 ~ 3800746 (+)
CI01000040_03761247_03762668 BOD1, FA44B coding upstream 477392 3761161 ~ 3762674 (+)
CI01000040_04369595_04374831 NA coding downstream 128186 4368465 ~ 4375355 (+)
CI01000040_04442810_04474877 MAP4K6 coding downstream 201518 4441797 ~ 4475124 (+)
CI01000040_04475476_04499896 NA coding downstream 235033 4475312 ~ 4500113 (+)
CI01000040_04503393_04506409 HMGB3B coding downstream 261444 4501723 ~ 4506409 (+)
CI01000040_04539382_04571810 TRPC5 coding downstream 298671 4538950 ~ 4571966 (+)
G186041 NA non-coding upstream 13576 4214116 ~ 4226490 (+)
G185959 NA non-coding upstream 230775 4009068 ~ 4009291 (+)
G185955 NA non-coding upstream 250145 3989680 ~ 3989921 (+)
G185938 NA non-coding upstream 272644 3967202 ~ 3967422 (+)
G185791 NA non-coding upstream 324606 3914585 ~ 3915460 (+)
G186064 NA non-coding downstream 11763 4252042 ~ 4252331 (+)
G186040 NA non-coding downstream 14708 4254987 ~ 4257290 (+)
G186128 NA non-coding downstream 169640 4409919 ~ 4410206 (+)
G186026 NA non-coding downstream 333532 4573811 ~ 4577465 (+)
G186601 NA non-coding downstream 427383 4667662 ~ 4670591 (+)
G185947 NA other upstream 265943 3973765 ~ 3974123 (+)
G185884 NA other upstream 500785 3738987 ~ 3739281 (+)
G185296 NA other upstream 906083 3333578 ~ 3333983 (+)
G184003 NA other upstream 3003577 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 3261903 977184 ~ 978163 (+)
G187510 NA other downstream 1728766 5969045 ~ 5971732 (+)
G188149 NA other downstream 2568412 6808691 ~ 6809130 (+)
CI01000040_06833701_06848731 NA other downstream 2597845 6832987 ~ 6849135 (+)

Expression


Co-expression Network