G223386


Basic Information

Item Value
gene id G223386
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 920951 ~ 921183 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU253390
GAAAGTAGCGATTCGTTTTTTAAAAGTAGTGATTCATTTTTGAAAAGTAGCGATTCAAAAGTAGCGATTCATTTTTGGAAAAGTAGCGATTCATTTTTTGAAAAGTAGCATTTCATTTTTGGAAAAGTAGCGATTCATTTTTGAAAAGTAGCGATTCATTTTTGAAAAGTAGCGATTCATTTTTGGGAAAGTAGCGATTTAAAAGTAGCGATTCATTTTTGGGAAAGTAGCGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU253390 True 233 lncRNA 0.31 1 920951 921183

Neighbor

gene id symbol gene type direction distance location
CI01000052_00906265_00916799 SEMA3B coding upstream 4138 904556 ~ 916813 (+)
CI01000052_00836931_00841228 TMEM51A coding upstream 79518 835368 ~ 841433 (+)
CI01000052_00793472_00831585 KAZNA coding upstream 88998 793472 ~ 831953 (+)
CI01000052_00714377_00725358 ZYMND12 coding upstream 195562 714377 ~ 725389 (+)
CI01000052_00702155_00711896 SLC16A1, MCT1A, SLC16A1A, SLC16A1B coding upstream 209055 702155 ~ 711896 (+)
CI01000052_01044855_01046432 NA coding downstream 123672 1044855 ~ 1046617 (+)
CI01000052_01143235_01145343 NA coding downstream 221973 1143156 ~ 1147150 (+)
CI01000052_01295531_01298937 NA coding downstream 373011 1294194 ~ 1299203 (+)
CI01000052_01368837_01373810 OPN7C coding downstream 447654 1368837 ~ 1374198 (+)
CI01000052_01383491_01401660 NA coding downstream 460967 1382150 ~ 1402229 (+)
G223376 NA non-coding upstream 144870 775842 ~ 776081 (+)
G223341 NA non-coding upstream 150439 718697 ~ 770512 (+)
G223342 NA non-coding upstream 184186 734821 ~ 736765 (+)
G223355 NA non-coding upstream 236183 684545 ~ 684768 (+)
G223476 NA non-coding downstream 71631 992814 ~ 993014 (+)
G223480 NA non-coding downstream 79175 1000358 ~ 1000639 (+)
G223450 NA non-coding downstream 97448 1018631 ~ 1019051 (+)
G223482 NA non-coding downstream 98986 1020169 ~ 1020655 (+)
G223458 NA non-coding downstream 100583 1021766 ~ 1022066 (+)
G223545 NA other downstream 349309 1270492 ~ 1270927 (+)
G223694 NA other downstream 1128143 2049326 ~ 2104299 (+)
G224953 NA other downstream 2509953 3431136 ~ 3460136 (+)

Expression


Co-expression Network