G223476


Basic Information

Item Value
gene id G223476
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 992814 ~ 993014 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU253490
GCTTGACGCGCGGTAAGTGAATTGACGCGTATTAGTAGGGTCGCTGTTCTGAGAGAGTGAAGAAAGGGGTGCATCTTTTTATGATCAACCTTCTTTATGTTCTATTATGTTTAAATCCTCCCTCGCTTTCTTTTTCTCTCTGACTTTCTCGTTTCGACCTTGTTTGGGTATCTGAACTGCTGAGAGAAAAGTGGTTTTGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU253490 True 201 lncRNA 0.42 1 992814 993014

Neighbor

gene id symbol gene type direction distance location
CI01000052_00906265_00916799 SEMA3B coding upstream 76001 904556 ~ 916813 (+)
CI01000052_00836931_00841228 TMEM51A coding upstream 151381 835368 ~ 841433 (+)
CI01000052_00793472_00831585 KAZNA coding upstream 160861 793472 ~ 831953 (+)
CI01000052_00714377_00725358 ZYMND12 coding upstream 267425 714377 ~ 725389 (+)
CI01000052_00702155_00711896 SLC16A1, MCT1A, SLC16A1A, SLC16A1B coding upstream 280918 702155 ~ 711896 (+)
CI01000052_01044855_01046432 NA coding downstream 51841 1044855 ~ 1046617 (+)
CI01000052_01143235_01145343 NA coding downstream 150142 1143156 ~ 1147150 (+)
CI01000052_01295531_01298937 NA coding downstream 301180 1294194 ~ 1299203 (+)
CI01000052_01368837_01373810 OPN7C coding downstream 375823 1368837 ~ 1374198 (+)
CI01000052_01383491_01401660 NA coding downstream 389136 1382150 ~ 1402229 (+)
G223386 NA non-coding upstream 71631 920951 ~ 921183 (+)
G223376 NA non-coding upstream 216733 775842 ~ 776081 (+)
G223341 NA non-coding upstream 222302 718697 ~ 770512 (+)
G223342 NA non-coding upstream 256049 734821 ~ 736765 (+)
G223480 NA non-coding downstream 7344 1000358 ~ 1000639 (+)
G223450 NA non-coding downstream 25617 1018631 ~ 1019051 (+)
G223482 NA non-coding downstream 27155 1020169 ~ 1020655 (+)
G223458 NA non-coding downstream 28752 1021766 ~ 1022066 (+)
G223416 NA non-coding downstream 30375 1023389 ~ 1026474 (+)
G223545 NA other downstream 277478 1270492 ~ 1270927 (+)
G223694 NA other downstream 1056312 2049326 ~ 2104299 (+)
G224953 NA other downstream 2438122 3431136 ~ 3460136 (+)

Expression


Co-expression Network