G232914


Basic Information

Item Value
gene id G232914
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 7067414 ~ 7067653 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264320
CAGAAGTGCTGTCGTGTCCTGTGGGCCAAGGCTCATTTAAAATGGACTGTTTCAAAGTGGAAAAGTGTTCTATGGTCAGACGAGTCCAAATTTGACATTCTTGTTGGAAATCACGGACGCCGTGTCCTCCGGGCTAAAGAGGAGGGAGACCTTCCAGCGTGTTATCAGCGTTCAGTTCAAAAGCCAGCATCTCTGTTGGTATGGCGGTGCATAAGTGCATACGGTATGGGCAGCTTGCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264320 True 240 lncRNA 0.49 1 7067414 7067653

Neighbor

gene id symbol gene type direction distance location
CI01000054_07040367_07056299 5NT1A, NT5C1AA coding upstream 9844 7040367 ~ 7057570 (+)
CI01000054_07019424_07021726 NA coding upstream 45103 7019424 ~ 7022311 (+)
CI01000054_07011099_07011947 NA coding upstream 55316 7011023 ~ 7012098 (+)
CI01000054_06990478_06999311 LAPTM4B coding upstream 68103 6990405 ~ 6999311 (+)
CI01000054_06974533_06985526 MTDHA coding upstream 80377 6973352 ~ 6987037 (+)
CI01000054_07119711_07124720 HPCA.S, HPCAL1, HPCA, HPCAL1.L coding downstream 52058 7119711 ~ 7124770 (+)
CI01000054_07145831_07153505 NA coding downstream 77852 7145505 ~ 7154654 (+)
CI01000054_07189617_07192052 ZBTB8B coding downstream 120324 7187977 ~ 7192069 (+)
CI01000054_07193147_07196114 FUCA1.1, FUCA1.2 coding downstream 125494 7193147 ~ 7196219 (+)
CI01000054_07198599_07202146 FUCA1.1, FUCA1.2 coding downstream 130946 7198599 ~ 7202293 (+)
G232848 NA non-coding upstream 58191 7007111 ~ 7009223 (+)
G232886 NA non-coding upstream 63440 7003611 ~ 7003974 (+)
G232883 NA non-coding upstream 121581 6945630 ~ 6945833 (+)
G232882 NA non-coding upstream 121818 6944556 ~ 6945596 (+)
G232876 NA non-coding upstream 150134 6915946 ~ 6917280 (+)
G232942 NA non-coding downstream 108686 7176339 ~ 7176575 (+)
G232944 NA non-coding downstream 110595 7178248 ~ 7178633 (+)
G232948 NA non-coding downstream 114249 7181902 ~ 7182155 (+)
G232907 NA non-coding downstream 150486 7218139 ~ 7219649 (+)
G232904 NA non-coding downstream 232027 7299680 ~ 7330015 (+)
G232870 NA other upstream 178911 6887912 ~ 6888503 (+)
G232659 NA other upstream 691520 6374850 ~ 6375894 (+)
CI01000054_06305908_06312122 NA other upstream 760554 6305908 ~ 6312163 (+)
G232558 NA other upstream 1025551 5993660 ~ 6041863 (+)
CI01000054_05608892_05634793 RNF19B other upstream 1442739 5608457 ~ 5634804 (+)
G233024 NA other downstream 499870 7567523 ~ 7609893 (+)
G233306 NA other downstream 1236946 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 1238284 8325126 ~ 8329716 (+)
G235560 NA other downstream 3320483 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 4497323 11564820 ~ 11568999 (+)

Expression


Co-expression Network