RNA id: TCONS_00000131


Basic Information

Item Value
RNA id TCONS_00000131
length 424
lncRNA type retained_intron
GC content 0.45
exon number 7
gene id XLOC_000067
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 6161930 ~ 6185532 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACAAATGGACACTGGCACGCAGGACGATTGCCATGAGGACTGTTTAGTGAACATCACAGACCTGGATCCAAATGCCGAAACTTATATGAACTTTATGAAGAAGCACTGCTGTTATGATGCAATTCCTACCAGCTGCAAACTGGTCATTTTTGACACAACACTGCAGGTGAAGAAGGCCTTCTTTGCATTGGTGGCCAACGGTTTAAGAGCGGCTCCTCTCTGGGACCACAAACTGCAGAGATTTGTGGGTATGCTGACGATCACAGATTTCATTAATATTCTGCATCGGTACTACAGATCTCCTATGGTTCAGATCTATGAACTGGAGGAGCACAAGATTGAGACATGGAGAGGTGATTCATTTCAAAATGTTTATCTGCAGTATCAAGACCAGTGTCTCATCAGTATCACTCCTGATGCCAG

Function

GO:

id name namespace
GO:0000079 regulation of cyclin-dependent protein serine/threonine kinase activity biological_process
GO:0000307 cyclin-dependent protein kinase holoenzyme complex cellular_component
GO:0005634 nucleus cellular_component
GO:0016538 cyclin-dependent protein serine/threonine kinase regulator activity molecular_function
GO:0019901 protein kinase binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-419 Predicted to enable AMP binding activity; protein kinase binding activity; and protein kinase regulator activity. Predicted to be involved in cellular response to glucose starvation; protein phosphorylation; and regulation of catalytic activity. Predicted to be part of nucleotide-activated protein kinase complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human PRKAG3 (protein kinase AMP-activated non-catalytic subunit gamma 3).

Ensembl:

ensembl_id ENSDART00000136060

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00000128 lncRNA upstream 5289 6162013 ~ 6166554 (+) False XLOC_000067
TCONS_00003020 lncRNA upstream 372751 5795013 ~ 5799092 (+) False XLOC_000065
TCONS_00003021 lncRNA upstream 372751 5795035 ~ 5799092 (+) True XLOC_000065
TCONS_00003019 lncRNA upstream 443159 5706970 ~ 5728684 (+) True XLOC_000064
TCONS_00003018 lncRNA upstream 858248 5311479 ~ 5313595 (+) False XLOC_000059
TCONS_00000135 lncRNA downstream 5007 6182344 ~ 6185532 (+) True XLOC_000067
TCONS_00000137 lncRNA downstream 12660 6189997 ~ 6196763 (+) False XLOC_000068
TCONS_00003022 lncRNA downstream 202541 6379878 ~ 6554470 (+) True XLOC_000072
TCONS_00003023 lncRNA downstream 220873 6398210 ~ 6403223 (+) True XLOC_000073
TCONS_00000148 lncRNA downstream 487696 6665033 ~ 6668339 (+) True XLOC_000076
TCONS_00000127 mRNA upstream 2026 6161930 ~ 6169817 (+) False XLOC_000067
TCONS_00000125 mRNA upstream 13234 6135176 ~ 6158609 (+) False XLOC_000066
TCONS_00000126 mRNA upstream 13234 6135188 ~ 6158609 (+) True XLOC_000066
TCONS_00000124 mRNA upstream 584268 5576151 ~ 5587575 (+) True XLOC_000063
TCONS_00000122 mRNA upstream 667713 5485799 ~ 5504130 (+) False XLOC_000062
TCONS_00000136 mRNA downstream 12612 6189949 ~ 6210718 (+) False XLOC_000068
TCONS_00000138 mRNA downstream 29613 6206950 ~ 6210718 (+) True XLOC_000068
TCONS_00000139 mRNA downstream 48156 6225493 ~ 6240518 (+) False XLOC_000069
TCONS_00000140 mRNA downstream 48798 6226135 ~ 6243978 (+) False XLOC_000069
TCONS_00000141 mRNA downstream 66569 6243906 ~ 6272146 (+) True XLOC_000069
TCONS_00000123 other upstream 669759 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000120 other upstream 684681 5437390 ~ 5487162 (+) False XLOC_000062
TCONS_00000121 other upstream 721399 5438743 ~ 5450444 (+) False XLOC_000062
TCONS_00000117 other upstream 753336 5402534 ~ 5418507 (+) True XLOC_000060
TCONS_00000111 other upstream 2411809 3759924 ~ 3760034 (+) True XLOC_000054
TCONS_00000134 other downstream 5005 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000149 other downstream 610353 6787690 ~ 6787804 (+) True XLOC_000078
TCONS_00000154 other downstream 886500 7063837 ~ 7063943 (+) True XLOC_000081
TCONS_00000208 other downstream 2976757 9154094 ~ 9155273 (+) False XLOC_000113
TCONS_00000209 other downstream 2977656 9154993 ~ 9155521 (+) False XLOC_000113

Expression Profile

//