RNA id: TCONS_00018586


Basic Information

Item Value
RNA id TCONS_00018586
length 689
RNA type mRNA
GC content 0.50
exon number 5
gene id XLOC_009463
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 39964943 ~ 39971756 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AATATTCTTTATTTTCCTCTAAAGATGGCTGAAGATTGGGAGGCTGCACCAGCTGTTGCTGAAACACCAGAGATCAAACTCTTTGGCAAGTGGAGCACAGATGATGTACAGATCAATGACATCTCCCTGCAGGATTACATTGCCGTGAAGGAGAAATACGCCAAATACCTCCCTCATTCCAGCGGCAGATACGCAGCCAAGCGTTTCCGTAAGGCTCAGTGTCCCATTGTGGAGCGCGTCACTAACTCCATGATGATGCACGGACGCAACAACGGCAAGAAACTGCTGACCGTTCGCATCGTCAAGCACGCTTTTGAGATCATCCACCTGCTCACTGGCGAGAATCCTCTGCAGATTCTGGTAAACGCCATCATCAACAGTGGCCCTCGTGAGGACTCCACCCGTATCGGACGTGCTGGAACCGTGAGGAGACAGGCTGTTGATGTGTCCCCCCTGCGCAGAGTCAACCAGGCCATCTGGCTGCTCTGCACTGGTGCAAGAGAAGCTGCTTTCAGGAACATCAAGACCATCGCAGAGTGTCTTGCTGACGAGCTCATCAACGCTGCCAAGGGTTCCTCCAACTCTTACGCCATCAAGAAGAAAGATGAGCTGGAGAGAGTGGCCAAGTCTAACCGCTAATCTCCATTTTGTATAAAATCGGATTACATTAAAAGAGGAAGAGTTAAACC

Function

GO:

id name namespace
GO:0000028 ribosomal small subunit assembly biological_process
GO:0006412 translation biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0019843 rRNA binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03010 Ribosome
ko04626 Plant-pathogen interaction
ko05171 Coronavirus disease - COVID-19
ko03011 Ribosome

ZFIN:

id description
ZDB-GENE-020419-12 Predicted to enable mRNA binding activity and rRNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosomal small subunit assembly and translation. Predicted to be part of cytosolic small ribosomal subunit. Predicted to be active in ribosome. Orthologous to human RPS5 (ribosomal protein S5).

Ensembl:

ensembl_id ENSDART00000146054

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018579 lncRNA downstream 116165 39847495 ~ 39848780 (-) False XLOC_009460
TCONS_00019223 lncRNA downstream 116376 39847491 ~ 39848569 (-) False XLOC_009460
TCONS_00019222 lncRNA downstream 144533 39763470 ~ 39820412 (-) False XLOC_009459
TCONS_00018574 lncRNA downstream 1012891 38949834 ~ 38952054 (-) False XLOC_009458
TCONS_00019224 lncRNA upstream 32876 40002864 ~ 40006262 (-) False XLOC_009464
TCONS_00019226 lncRNA upstream 32876 40002864 ~ 40006263 (-) False XLOC_009464
TCONS_00019225 lncRNA upstream 32876 40002864 ~ 40006263 (-) False XLOC_009464
TCONS_00019227 lncRNA upstream 32876 40002864 ~ 40006264 (-) False XLOC_009464
TCONS_00019228 lncRNA upstream 32876 40002864 ~ 40006538 (-) True XLOC_009464
TCONS_00018584 mRNA downstream 1936 39957809 ~ 39963009 (-) True XLOC_009462
TCONS_00018583 mRNA downstream 9160 39935752 ~ 39955785 (-) True XLOC_009461
TCONS_00018582 mRNA downstream 16310 39934295 ~ 39948635 (-) False XLOC_009461
TCONS_00018581 mRNA downstream 19909 39934295 ~ 39945036 (-) False XLOC_009461
TCONS_00018580 mRNA downstream 116123 39847495 ~ 39848822 (-) True XLOC_009460
TCONS_00018587 mRNA upstream 70167 40040155 ~ 40041455 (-) True XLOC_009465
TCONS_00018588 mRNA upstream 81230 40051218 ~ 40065296 (-) False XLOC_009466
TCONS_00018589 mRNA upstream 81263 40051251 ~ 40065265 (-) True XLOC_009466
TCONS_00018593 mRNA upstream 167576 40137564 ~ 40175894 (-) False XLOC_009469
TCONS_00018594 mRNA upstream 180717 40150705 ~ 40157165 (-) False XLOC_009469
TCONS_00018535 other downstream 2235779 37727834 ~ 37729166 (-) True XLOC_009432
TCONS_00018517 other downstream 3090579 36874251 ~ 36874366 (-) True XLOC_009420
TCONS_00018513 other downstream 3431698 36529465 ~ 36533247 (-) True XLOC_009417
TCONS_00018488 other downstream 4752708 35167295 ~ 35212237 (-) True XLOC_009400
TCONS_00018481 other downstream 4852159 35095205 ~ 35112786 (-) False XLOC_009398
TCONS_00018590 other upstream 99023 40069011 ~ 40069127 (-) True XLOC_009467
TCONS_00018622 other upstream 1423413 41393401 ~ 41396073 (-) True XLOC_009478
TCONS_00018633 other upstream 1559272 41529260 ~ 41543440 (-) True XLOC_009482
TCONS_00018660 other upstream 2307685 42277673 ~ 42283815 (-) True XLOC_009502
TCONS_00018661 other upstream 2558802 42528790 ~ 42528904 (-) True XLOC_009503

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000095_04358210_04362581.mRNA True 1150 mRNA 0.42 5 CI01000095 4357703 ~ 4362609 (+)
bowfin (Amia calva) AMCG00006304 True 819 mRNA 0.61 8 CM030134.1 1808656 ~ 1818368 (-)