RNA id: TCONS_00026301


Basic Information

Item Value
RNA id TCONS_00026301
length 389
RNA type mRNA
GC content 0.43
exon number 4
gene id XLOC_013296
representative False

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 14334123 ~ 14337458 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGTGCAGACATTACTGCAGCAGATGCAGGATAAGTTCCAGACAATGTCAGACCAGATCATCGGGAGAATTGATGAAATGAGCACCCGCATTGATGACCTGGAGAAGAATATAGCAGACCTGATGACTCAGGCAGGAGTGGAAGAGATTGAAGGAGAGAACAAGGTCAAAGAGGGAGACGCCTCCTAGTAGAGGATGCAGAGTTGAACGAATAAAACTATACACACACTCTTCAGGAGCAGCAAGATTCTCTCTATGAACTTTTTAAACATGACATCCAACTGTAGAGCCGAATCCTGCGTTACTGTAATAACAGCACTAGCCCAAGTGCCAACCTATCACCATTCCTGTTAAAGCCAGTTTGTTGTTGAATTAAAAGTTGTTTCTTAAA

Function

GO:

id name namespace
GO:0014029 neural crest formation biological_process
GO:0007417 central nervous system development biological_process
GO:0004252 serine-type endopeptidase activity molecular_function
GO:0003714 transcription corepressor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1721 Predicted to enable serine-type endopeptidase activity. Acts upstream of or within central nervous system development and neural crest formation. Is expressed in head. Orthologous to human HSBP1 (heat shock factor binding protein 1).

Ensembl:

ensembl_id ENSDART00000135703

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00026294 lncRNA downstream 1046607 13281654 ~ 13287651 (-) True XLOC_013291
TCONS_00027274 lncRNA downstream 1219940 13077843 ~ 13114318 (-) True XLOC_013288
TCONS_00027273 lncRNA downstream 1470735 12862604 ~ 12863523 (-) True XLOC_013284
TCONS_00027272 lncRNA downstream 1970929 12358383 ~ 12363329 (-) True XLOC_013278
TCONS_00027271 lncRNA downstream 1980070 12351884 ~ 12354188 (-) True XLOC_013277
TCONS_00027275 lncRNA upstream 426838 14763903 ~ 14765883 (-) True XLOC_013300
TCONS_00027276 lncRNA upstream 850952 15188017 ~ 15191812 (-) True XLOC_013310
TCONS_00026327 lncRNA upstream 958971 15296036 ~ 15311911 (-) False XLOC_013312
TCONS_00026328 lncRNA upstream 981321 15318386 ~ 15320930 (-) True XLOC_013312
TCONS_00026330 lncRNA upstream 1030435 15367500 ~ 15370455 (-) True XLOC_013313
TCONS_00026299 mRNA downstream 59455 14233553 ~ 14274803 (-) True XLOC_013295
TCONS_00026296 mRNA downstream 971332 13326724 ~ 13362926 (-) True XLOC_013292
TCONS_00026295 mRNA downstream 974152 13324140 ~ 13360106 (-) False XLOC_013292
TCONS_00026293 mRNA downstream 1130857 13201669 ~ 13203401 (-) True XLOC_013290
TCONS_00026292 mRNA downstream 1130907 13201669 ~ 13203351 (-) False XLOC_013290
TCONS_00026303 mRNA upstream 334724 14671789 ~ 14677936 (-) True XLOC_013297
TCONS_00026304 mRNA upstream 351578 14688643 ~ 14691727 (-) True XLOC_013298
TCONS_00026305 mRNA upstream 394719 14731784 ~ 14734678 (-) False XLOC_013299
TCONS_00026306 mRNA upstream 394719 14731784 ~ 14743659 (-) True XLOC_013299
TCONS_00026307 mRNA upstream 435409 14772474 ~ 14777092 (-) False XLOC_013301
TCONS_00026298 other downstream 789891 13544250 ~ 13544367 (-) True XLOC_013294
TCONS_00026297 other downstream 856036 13477102 ~ 13478222 (-) True XLOC_013293
TCONS_00026288 other downstream 1388527 12945617 ~ 12945731 (-) True XLOC_013286
TCONS_00026284 other downstream 1568806 12761610 ~ 12765452 (-) True XLOC_013282
TCONS_00026283 other downstream 1571566 12760802 ~ 12762692 (-) False XLOC_013282
TCONS_00026312 other upstream 529318 14866383 ~ 14871136 (-) True XLOC_013303
TCONS_00026322 other upstream 699086 15036151 ~ 15036269 (-) True XLOC_013308
TCONS_00026338 other upstream 1241437 15578502 ~ 15610237 (-) True XLOC_013318
TCONS_00026339 other upstream 1251022 15588087 ~ 15588201 (-) True XLOC_013319
TCONS_00026341 other upstream 1538597 15875662 ~ 15875780 (-) True XLOC_013321

Expression Profile

//