RNA id: TCONS_00027804



Basic Information


Item Value
RNA id TCONS_00027804
length 708
RNA type mRNA
GC content 0.51
exon number 2
gene id XLOC_013913
representative True

Chromosome Information


Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 10845953 ~ 10850834 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AACATGATGTGGCAGGACCAACCAATGCCCAGCATGGACCTGGTGAAAAATGCTTTCTGGAATTACGTTTCTCAAGCGACCCTCACAGCTGAGGAAACACTTCAGATGATCAGAAACTCAGAGCTGGGTCAAGAAATCAATGACAGGATCTCTAAAAGCACAGATGCCATCAATAAATACACCCTGGCCATTCAAAGTCAGGTCACTCCTTTGACCCAAGAACTGCTCACCAAACTGTCCCAGGAGGCCGATCAGCTGAAACTGAGTCTGGAGCAAGAAATCACCTCGGCACAGACCCAGCTCAAGCCTTATGTTGAAGAACTCAAAGTGGACATTGAGGAGCAGATTGAGCGGCTGAAAAAGGACGTGGCTCCATACGCAGAGGCCCTGAACCCTGAAGCCATGAGGTTGACCCTGGTCCTGCGGGCTGAAGAGCTGAAGGCAAAGCTGGAAACAAGTTTGATGGCGATGGGTCCTCAGAGCGAGGAGCTGAAGCAGAAGCTGGAGCAGCACTTTGTGGAGTTTCAGATGAGCATGTCTCCACTGGCTGAGAGTTTTCAGAGTCAGCTGGCCCAGAGAAGTCAGGAGCTCCAGAAGAATCTGGCTCCCTATTCTGAAGAGCTGAGCAAACTAGATCCGCTCGCTCAGGATCTGAAGGACCAGCTGACTGCCCTCTGGGAGTCCTTCGCCAAGGATAAACAGTCGTGA

Function


GO:

id name namespace
GO:0042157 lipoprotein metabolic process biological_process
GO:0006869 lipid transport biological_process
GO:0005576 extracellular region cellular_component
GO:0008289 lipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050417-469 Predicted to enable lipid binding activity. Predicted to act upstream of or within lipid transport and lipoprotein metabolic process. Predicted to be located in extracellular region. Is expressed in intestine; liver; and yolk syncytial layer. Human ortholog(s) of this gene implicated in Alzheimer's disease; colitis; myocardial infarction; and ulcerative colitis. Orthologous to human APOA4 (apolipoprotein A4).

Ensembl:

ensembl_id ENSDART00000189784

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00027795 lncRNA upstream 172512 10673830 ~ 10674606 (+) True XLOC_013910
TCONS_00027787 lncRNA upstream 272129 10565683 ~ 10574989 (+) True XLOC_013905
TCONS_00029876 lncRNA upstream 980396 9838182 ~ 9866722 (+) True XLOC_013895
TCONS_00027766 lncRNA upstream 1090102 9751075 ~ 9757016 (+) True XLOC_013893
TCONS_00027762 lncRNA upstream 1263589 9533277 ~ 9583529 (+) False XLOC_013891
TCONS_00027811 lncRNA downstream 162906 11013622 ~ 11014858 (+) True XLOC_013918
TCONS_00029877 lncRNA downstream 1444734 12295450 ~ 12300891 (+) True XLOC_013928
TCONS_00027828 lncRNA downstream 1566798 12417514 ~ 12420573 (+) True XLOC_013930
TCONS_00027840 lncRNA downstream 2251508 13102224 ~ 13120278 (+) True XLOC_013936
TCONS_00029698 lncRNA downstream 2264549 13115265 ~ 13115526 (+) True XLOC_013937
TCONS_00027801 mRNA upstream 2031 10832092 ~ 10845087 (+) True XLOC_013912
TCONS_00027799 mRNA upstream 5203 10831362 ~ 10841915 (+) False XLOC_013912
TCONS_00027797 mRNA upstream 20403 10794105 ~ 10826715 (+) False XLOC_013911
TCONS_00027798 mRNA upstream 20648 10799929 ~ 10826470 (+) True XLOC_013911
TCONS_00027796 mRNA upstream 33319 10794072 ~ 10813799 (+) False XLOC_013911
TCONS_00027805 mRNA downstream 4442 10855158 ~ 10859694 (+) False XLOC_013914
TCONS_00027806 mRNA downstream 4575 10855291 ~ 10856175 (+) True XLOC_013914
TCONS_00027807 mRNA downstream 9769 10860485 ~ 10872469 (+) False XLOC_013915
TCONS_00027808 mRNA downstream 12404 10863120 ~ 10870932 (+) True XLOC_013915
TCONS_00027809 mRNA downstream 87216 10937932 ~ 10950839 (+) True XLOC_013916
TCONS_00027800 other upstream 11497 10832092 ~ 10835621 (+) False XLOC_013912
TCONS_00027788 other upstream 279632 10567371 ~ 10567486 (+) True XLOC_013906
TCONS_00027758 other upstream 1403240 9443772 ~ 9443878 (+) True XLOC_013889
TCONS_00027757 other upstream 1417174 9429857 ~ 9429944 (+) True XLOC_013888
TCONS_00027739 other upstream 1677893 9150094 ~ 9169225 (+) False XLOC_013879
TCONS_00027817 other downstream 427697 11278413 ~ 11278529 (+) True XLOC_013922
TCONS_00027836 other downstream 2094134 12944850 ~ 12944966 (+) True XLOC_013935
TCONS_00027847 other downstream 2983163 13833879 ~ 13833993 (+) True XLOC_013944
TCONS_00027852 other downstream 3260255 14110971 ~ 14112909 (+) True XLOC_013947
TCONS_00027859 other downstream 3544163 14394879 ~ 14398687 (+) True XLOC_013950

Expression Profile


//