RNA id: TCONS_00032483


Basic Information

Item Value
RNA id TCONS_00032483
length 494
lncRNA type retained_intron
GC content 0.48
exon number 3
gene id XLOC_016508
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 31891335 ~ 31937005 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCAGTCTTCTGATTGTGTCCTTGTAAATGTACATAAAGCCTGAAGCCGAGGCTGAGGCCCCAGAGGGTGATGTAGCTGAAGGAGAAGGTGAAGCATCTCCAGCCTCAGAACCTGAGGGTGGAGAGGGTCCTGTCACCACTCCTCCAACAGACACACAACCTGAGGAGATAACAGCTTCAAGCCCTCCCGCTGAAACGCCCACTAGCACTGTGGAGTCTCCAGTGTCTGCTGAGCCTGAAGCAGCTGAGCAGGCTGAGCTCCCAGTTGAGGACATAGAAAAGGAGCAACTCAGTGAAGAATCCCCGGTAACTATAACTTATGTCTAATGAATGGCATAGGAGAAACTCAAGTCATATGCAGCACTGTCGCATATGTGCTTGCTTTCGTACTGTATCTAGCAAATTTTCTGTAGAAACAGCCATTTGGCTTTAGCAACGTGTGAAAATGAATTATGTATGAGATGCAAGATATTATAGGCGAACAGGTGGTGTTAT

Function

GO:

id name namespace
GO:0048488 synaptic vesicle endocytosis biological_process
GO:0005886 plasma membrane cellular_component
GO:0008021 synaptic vesicle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005543 phospholipid binding molecular_function

KEGG:

id description
ko04144 Endocytosis
ko04666 Fc gamma R-mediated phagocytosis
ko01002 Peptidases and inhibitors
ko01011 Peptidoglycan biosynthesis and degradation proteins
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-040426-1711 Predicted to enable phospholipid binding activity. Predicted to be involved in synaptic vesicle endocytosis. Located in cytoplasm. Is expressed in several structures, including fin; gonad; heart; nervous system; and neural tube. Orthologous to human AMPH (amphiphysin).

Ensembl:

ensembl_id ENSDART00000158051

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033869 lncRNA downstream 14490 31882407 ~ 31883178 (-) False XLOC_016505
TCONS_00033868 lncRNA downstream 282920 31612853 ~ 31614748 (-) True XLOC_016485
TCONS_00032444 lncRNA downstream 284391 31612853 ~ 31613277 (-) False XLOC_016485
TCONS_00033867 lncRNA downstream 788721 31092749 ~ 31108947 (-) True XLOC_016480
TCONS_00033866 lncRNA downstream 797791 31092749 ~ 31099877 (-) False XLOC_016480
TCONS_00033870 lncRNA upstream 295918 32194825 ~ 32201587 (-) True XLOC_016510
TCONS_00032488 lncRNA upstream 318558 32217465 ~ 32220224 (-) False XLOC_016511
TCONS_00033871 lncRNA upstream 318558 32217465 ~ 32232159 (-) False XLOC_016511
TCONS_00032491 lncRNA upstream 337328 32236235 ~ 32262287 (-) True XLOC_016511
TCONS_00032504 lncRNA upstream 479670 32378577 ~ 32384643 (-) False XLOC_016514
TCONS_00032462 mRNA downstream 64321 31830183 ~ 31833347 (-) True XLOC_016490
TCONS_00032461 mRNA downstream 97147 31781843 ~ 31800521 (-) True XLOC_016489
TCONS_00032460 mRNA downstream 98951 31781843 ~ 31798717 (-) False XLOC_016489
TCONS_00032459 mRNA downstream 106035 31781843 ~ 31791633 (-) False XLOC_016489
TCONS_00032458 mRNA downstream 129841 31762852 ~ 31767827 (-) True XLOC_016488
TCONS_00032484 mRNA upstream 216944 32115851 ~ 32119196 (-) True XLOC_016509
TCONS_00032485 mRNA upstream 316365 32215272 ~ 32262287 (-) False XLOC_016511
TCONS_00032486 mRNA upstream 316548 32215455 ~ 32237916 (-) False XLOC_016511
TCONS_00032487 mRNA upstream 316548 32215455 ~ 32262287 (-) False XLOC_016511
TCONS_00032490 mRNA upstream 321473 32220380 ~ 32247341 (-) False XLOC_016511
TCONS_00032479 other downstream 8260 31888975 ~ 31889408 (-) True XLOC_016507
TCONS_00032478 other downstream 11649 31885581 ~ 31886019 (-) True XLOC_016506
TCONS_00032477 other downstream 14820 31882411 ~ 31882848 (-) True XLOC_016505
TCONS_00032476 other downstream 17036 31880194 ~ 31880632 (-) True XLOC_016504
TCONS_00032475 other downstream 19843 31877471 ~ 31877825 (-) True XLOC_016503
TCONS_00032489 other upstream 321002 32219909 ~ 32232159 (-) False XLOC_016511
TCONS_00032495 other upstream 394494 32293401 ~ 32293516 (-) True XLOC_016513
TCONS_00032496 other upstream 456521 32355428 ~ 32356050 (-) True XLOC_016512
TCONS_00032499 other upstream 458988 32357895 ~ 32361774 (-) False XLOC_016514
TCONS_00032501 other upstream 459132 32358039 ~ 32361463 (-) False XLOC_016514

Expression Profile

//