RNA id: TCONS_00035073


Basic Information

Item Value
RNA id TCONS_00035073
length 474
RNA type mRNA
GC content 0.43
exon number 4
gene id XLOC_017722
representative False

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 51478939 ~ 51482683 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTTGTCTCCATAGGATGGCAAGGTTGTCTATTTATTAGACTGAAAAGTTGGGAAACAGACCAAACGAAGGAAGAGAGAACAAGAGAAACCCGCGCACATCTGTGAAGTATTCAGTATCAAATGACTGCAGAAACGGATAAACAGGGCAACACGATGGATTAATGGGCGAACAGAGATTCCAGAATGGCAGCTACATACACTTTATTTCTGATGCTATTATTCATTTGGACTCCAACAGTGAAATCCACCTCAGTGTGTTCAACTGATGGCTACTTCGCTTTCTGCATGGACAGAGGTCTTCAAGAGCTCTAGAAGTCCTCATCCTGATGCACCAAACACCAGGTCTTGTGATCCGGCGCAATTCATTCATGAGGCTCTCTAATTTAACATCACTTCAGCTAGACTACAACCACCACCTGCGAATAGATGCAGGAGCATTTAATGGATTATCCGACCTTAAAAATCTCACTCTCA

Function

GO:

id name namespace
GO:0045087 innate immune response biological_process
GO:0002253 activation of immune response biological_process
GO:0042742 defense response to bacterium biological_process
GO:0006954 inflammatory response biological_process
GO:0001819 positive regulation of cytokine production biological_process
GO:0002376 immune system process biological_process
GO:0002755 MyD88-dependent toll-like receptor signaling pathway biological_process
GO:0002224 toll-like receptor signaling pathway biological_process
GO:0007165 signal transduction biological_process
GO:0034146 toll-like receptor 5 signaling pathway biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0038023 signaling receptor activity molecular_function
GO:0004888 transmembrane signaling receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040219-14 Predicted to enable signaling receptor activity. Acts upstream of or within activation of immune response and toll-like receptor signaling pathway. Predicted to be located in cytoplasm and membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Human ortholog(s) of this gene implicated in Legionnaires' disease; cystic fibrosis; cystitis; melioidosis; and systemic lupus erythematosus. Orthologous to human TLR5 (toll like receptor 5).

Ensembl:

ensembl_id ENSDART00000149758

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036745 lncRNA upstream 67760 51407080 ~ 51411179 (+) False XLOC_017720
TCONS_00036746 lncRNA upstream 69907 51407354 ~ 51409032 (+) False XLOC_017720
TCONS_00036747 lncRNA upstream 69907 51407514 ~ 51409032 (+) True XLOC_017720
TCONS_00035069 lncRNA upstream 69937 51407080 ~ 51409002 (+) False XLOC_017720
TCONS_00035068 lncRNA upstream 87650 51389901 ~ 51391289 (+) True XLOC_017719
TCONS_00036748 lncRNA downstream 1704 51481968 ~ 51482683 (+) True XLOC_017722
TCONS_00036749 lncRNA downstream 167330 51647594 ~ 51667197 (+) False XLOC_017724
TCONS_00036750 lncRNA downstream 167376 51647640 ~ 51667197 (+) True XLOC_017724
TCONS_00036430 lncRNA downstream 455039 51935303 ~ 52016412 (+) False XLOC_017727
TCONS_00036431 lncRNA downstream 488183 51968447 ~ 51977873 (+) False XLOC_017727
TCONS_00035072 mRNA upstream 2090 51471921 ~ 51476849 (+) True XLOC_017721
TCONS_00035071 mRNA upstream 2785 51466046 ~ 51476154 (+) False XLOC_017721
TCONS_00035070 mRNA upstream 12868 51464670 ~ 51466071 (+) False XLOC_017721
TCONS_00035067 mRNA upstream 144410 51312883 ~ 51334529 (+) True XLOC_017718
TCONS_00035063 mRNA upstream 265110 51199666 ~ 51213829 (+) False XLOC_017717
TCONS_00035076 mRNA downstream 250394 51730658 ~ 51753885 (+) True XLOC_017725
TCONS_00035077 mRNA downstream 333168 51813432 ~ 51874288 (+) False XLOC_017726
TCONS_00035078 mRNA downstream 352766 51833030 ~ 51874288 (+) True XLOC_017726
TCONS_00035084 mRNA downstream 909594 52389858 ~ 52447533 (+) False XLOC_017733
TCONS_00035083 mRNA downstream 909594 52389858 ~ 52447533 (+) False XLOC_017733
TCONS_00035066 other upstream 266891 51211932 ~ 51212048 (+) True XLOC_017717
TCONS_00035033 other upstream 2445821 49033004 ~ 49033118 (+) True XLOC_017695
TCONS_00035023 other upstream 2865503 48613321 ~ 48613436 (+) True XLOC_017687
TCONS_00035022 other upstream 2866569 48612257 ~ 48612370 (+) True XLOC_017686
TCONS_00035021 other upstream 2867629 48611195 ~ 48611310 (+) True XLOC_017685
TCONS_00035075 other downstream 35938 51516202 ~ 51516318 (+) True XLOC_017723
TCONS_00035099 other downstream 1439592 52919856 ~ 52919986 (+) True XLOC_017742

Expression Profile

//