RNA id: TCONS_00040484



Basic Information


Item Value
RNA id TCONS_00040484
length 796
RNA type mRNA
GC content 0.54
exon number 1
gene id XLOC_020397
representative True

Chromosome Information


Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 20546612 ~ 20547407 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GCCTCTAGCAGACGCTTGTCTTCCTTCCTCCACTGGTGAGATCTCAGTCAGCAAAGACGAACCCGGAAATCTAAGGAGGCGTCTTCCGCTCACCGGCTCGTCCACACTGGCAAGGCGACTCTTCCACTTCCAGTCATACCGTAATCCACTCATTACCAGCAGACGGCGTAAACGTGAGATGACCCCCTCAGAGAAAAAAGACGCGTCATATTGGGTCAAGCGAAAGAAGAACAACGAGGCTGCCAAACGGTCCAGAGAGAAGCGTCGACTCAATGACTTCATGCTGGAGGGACAGCTTCTGGCGCTGAGCGAAGAGAATGCCCAGCTCAGGGCTGAGGTGCTGAGTCTGCAGTATCACATGGGAATCGCACGAAGTCTGGATGTCAATCATCCCATCATGCCCTTTCCCTATCCTGTTATGTCCCATCTCAAGCCTTCCCTGTGGGGTTTGGCTACCAGTGCTGCTCCTCTTCCAGCTGAAGTCCCAGATCTGTACTCCTCTTGGTCACAGCACAGCTCATCTCCATTCATCTCGCCCTTGAGGGTGCCTCCTAAAAGTGCAAACCTACCTTCACAGGTTGGCCATTTGGACAACATTGTTGACCCAGTAGAGGCGAATCCAGCATCTCACCCACAGGTCTCTTCAAGCAACGACCCACCGAGCCACCCACAATTGTTTCCTGCCCAAAAAGCATCTGCGGCTTCACCGCCCCCTCCCCAGTTGTTACCAGGCCTGAGCCACTCTGCCAGCCAGAACAACAGCCAGATGTTACCCTGGGGCTCGTCGTCTTTGCGT

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0006955 immune response biological_process
GO:0007623 circadian rhythm biological_process
GO:0005634 nucleus cellular_component
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070424-213 Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in circadian rhythm and regulation of transcription, DNA-templated. Predicted to act upstream of or within immune response and transcription by RNA polymerase II. Predicted to be active in nucleus.

Ensembl:

ensembl_id ENSDART00000141852

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00041896 lncRNA upstream 112595 20433570 ~ 20434017 (+) True XLOC_020395
TCONS_00042134 lncRNA upstream 213778 20312803 ~ 20332834 (+) False XLOC_020393
TCONS_00042135 lncRNA upstream 213778 20313205 ~ 20332834 (+) True XLOC_020393
TCONS_00042133 lncRNA upstream 281085 20261231 ~ 20265527 (+) True XLOC_020392
TCONS_00042132 lncRNA upstream 287265 20247909 ~ 20259347 (+) True XLOC_020391
TCONS_00042136 lncRNA downstream 24427 20571834 ~ 20573960 (+) True XLOC_020399
TCONS_00042137 lncRNA downstream 587302 21134709 ~ 21141119 (+) True XLOC_020403
TCONS_00040493 lncRNA downstream 732314 21279721 ~ 21281352 (+) True XLOC_020405
TCONS_00040504 lncRNA downstream 1108022 21655429 ~ 21658284 (+) False XLOC_020411
TCONS_00040505 lncRNA downstream 1108066 21655473 ~ 21658284 (+) True XLOC_020411
TCONS_00040483 mRNA upstream 73045 20461488 ~ 20473567 (+) True XLOC_020396
TCONS_00040482 mRNA upstream 117238 20427170 ~ 20429374 (+) True XLOC_020394
TCONS_00040481 mRNA upstream 305380 20208185 ~ 20241232 (+) True XLOC_020389
TCONS_00040479 mRNA upstream 305675 20195280 ~ 20240937 (+) False XLOC_020389
TCONS_00040480 mRNA upstream 343320 20195298 ~ 20203292 (+) False XLOC_020389
TCONS_00040485 mRNA downstream 12634 20560041 ~ 20560787 (+) True XLOC_020398
TCONS_00040486 mRNA downstream 163027 20710434 ~ 20712654 (+) True XLOC_020400
TCONS_00040487 mRNA downstream 173401 20720808 ~ 20747062 (+) True XLOC_020401
TCONS_00040489 mRNA downstream 605440 21152847 ~ 21165192 (+) False XLOC_020404
TCONS_00040490 mRNA downstream 605624 21153031 ~ 21164560 (+) True XLOC_020404
TCONS_00040475 other upstream 394631 20151925 ~ 20151981 (+) True XLOC_020387
TCONS_00040472 other upstream 407020 20139525 ~ 20139592 (+) True XLOC_020385
TCONS_00040470 other upstream 753379 19793119 ~ 19793233 (+) True XLOC_020381
TCONS_00040469 other upstream 774800 19771698 ~ 19771812 (+) True XLOC_020380
TCONS_00040420 other upstream 1308386 19237031 ~ 19238226 (+) True XLOC_020360
TCONS_00040488 other downstream 546444 21093851 ~ 21093965 (+) True XLOC_020402
TCONS_00040522 other downstream 2018767 22566174 ~ 22588719 (+) True XLOC_020427
TCONS_00040524 other downstream 2293151 22840558 ~ 22840675 (+) True XLOC_020429
TCONS_00040525 other downstream 2408325 22955732 ~ 22955849 (+) True XLOC_020430
TCONS_00040526 other downstream 2548281 23095688 ~ 23095804 (+) True XLOC_020431

Expression Profile


//