RNA id: TCONS_00040920


Basic Information

Item Value
RNA id TCONS_00040920
length 609
RNA type mRNA
GC content 0.55
exon number 2
gene id XLOC_020746
representative True

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 3336723 ~ 3344613 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATCGCCCACCCTTACCTCCAGGTTCCCGGTTCCTGGTGCTTCCTCAACATCAGCTCTGCTCCTCTGGATATGACGTTCGGTCTGATCTTCTCGCTGGTGGGTTTGGCGTCTCTGGCCGTGTCGTTCCTGCTGAACACTGTGAGCGTGGTCACATTATTACGGGTGTGTTGTGGAGCCGACAGCACTCAGAGGAGGCGCGACTACGAGGTGGAGATGATGGTGCAGCTCATCTTGATCATGGTGATCGCCTCCATCTGCTGGTGCCCTCTGCTGGTGTTTATAGCGCAGACCGTGCTGTCAGGAAGTGAGCTCGATGTTCGATACCTGCTGCTCTGGCTGCGCTTTGCGACAGGAAATCAAGTCCTGGATCCCTGGGTTTACATCCTGTTCCGACGTGCCATACTGAAGCGAGTCGCTCCCAAAATGGATTGGTCCCGCGGATCCATCGTCAGCCTTTACCCAACGCTCTCTACGTCATTTCGCAAACTAACTCGAGCCTCTCTTGGGGGAACGCTTGACCGTCTGGATCACATTCGGCCAAATCAATGCATTGTCAGACAAGAGGATACACCTTTACCTGTGCTGGACACCTCTGCAACTTCCGTTTAG

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0004960 thromboxane receptor activity molecular_function
GO:0004961 thromboxane A2 receptor activity molecular_function

KEGG:

id description
ko04020 Calcium signaling pathway
ko04080 Neuroactive ligand-receptor interaction
ko04611 Platelet activation
ko04030 G protein-coupled receptors

ZFIN:

id description
ZDB-GENE-131016-6 Enables thromboxane A2 receptor activity. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Is expressed in gill; muscle; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in aspirin-induced respiratory disease; asthma; and blood platelet disease. Orthologous to human TBXA2R (thromboxane A2 receptor).

Ensembl:

ensembl_id ENSDART00000165600

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00040911 lncRNA downstream 184577 3147100 ~ 3152146 (-) True XLOC_020742
TCONS_00042296 lncRNA downstream 444177 2889663 ~ 2892546 (-) True XLOC_020738
TCONS_00042295 lncRNA downstream 508637 2814463 ~ 2828086 (-) True XLOC_020736
TCONS_00042293 lncRNA downstream 511022 2795028 ~ 2825701 (-) True XLOC_020734
TCONS_00042297 lncRNA upstream 2900 3347513 ~ 3347884 (-) True XLOC_020747
TCONS_00042298 lncRNA upstream 395973 3740586 ~ 3741284 (-) True XLOC_020749
TCONS_00042299 lncRNA upstream 538994 3883607 ~ 3886684 (-) True XLOC_020750
TCONS_00042300 lncRNA upstream 1388394 4733007 ~ 4735337 (-) True XLOC_020756
TCONS_00042301 lncRNA upstream 1400494 4745107 ~ 4746442 (-) True XLOC_020758
TCONS_00040916 mRNA downstream 37368 3262413 ~ 3299355 (-) False XLOC_020745
TCONS_00040918 mRNA downstream 37623 3263428 ~ 3299100 (-) False XLOC_020745
TCONS_00040917 mRNA downstream 52700 3263428 ~ 3284023 (-) False XLOC_020745
TCONS_00040919 mRNA downstream 60835 3273344 ~ 3275888 (-) True XLOC_020745
TCONS_00040914 mRNA downstream 74844 3252936 ~ 3261879 (-) False XLOC_020744
TCONS_00040921 mRNA upstream 44734 3389347 ~ 3564563 (-) False XLOC_020748
TCONS_00040922 mRNA upstream 45297 3389910 ~ 3595439 (-) False XLOC_020748
TCONS_00040923 mRNA upstream 103311 3447924 ~ 3449282 (-) False XLOC_020748
TCONS_00040925 mRNA upstream 565997 3910610 ~ 3914222 (-) False XLOC_020751
TCONS_00040928 mRNA upstream 566118 3910731 ~ 3914162 (-) False XLOC_020751
TCONS_00040899 other downstream 2106701 1229906 ~ 1230022 (-) True XLOC_020689
TCONS_00040895 other downstream 2176974 1158069 ~ 1159749 (-) False XLOC_020686
TCONS_00040885 other downstream 2519316 812920 ~ 817407 (-) True XLOC_020678
TCONS_00040857 other downstream 2989309 344918 ~ 347414 (-) False XLOC_020658
TCONS_00040924 other upstream 250655 3595268 ~ 3680725 (-) True XLOC_020748
TCONS_00040930 other upstream 967190 4311803 ~ 4313118 (-) True XLOC_020752
TCONS_00040947 other upstream 1474797 4819410 ~ 4899294 (-) False XLOC_020764
TCONS_00040949 other upstream 1483343 4827956 ~ 4899294 (-) False XLOC_020764
TCONS_00040955 other upstream 1553973 4898586 ~ 4899116 (-) True XLOC_020764

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000031_00452467_00455338.mRNA True 1824 mRNA 0.44 2 CI01000031 452467 ~ 456187 (+)