RNA id: TCONS_00042818



Basic Information


Item Value
RNA id TCONS_00042818
length 527
RNA type processed_transcript
GC content 0.43
exon number 4
gene id XLOC_021567
representative False

Chromosome Information


Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 16889152 ~ 16918191 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AGGACTGGTGTCAGTTTTACATCCTAAATAAGAATCGACGTAACCTGCTCAAAAATCCCAAAGCTGAAGCTGGATTGCAAGGATGGGAGATTATGGGTAATAGAAAGGCCTGCTGGCTAATGGAAGAAAATAGAAAACCATTCCCGGACAACACAGTCACCAGATGTTATGTAGCATTTAATGGGTTGTGTTTGAAGCGACAGCTGATTGATTTGCAGAAAGAAGGCTACAGTGCTGCTTTCATGGATCAACTGCAACCTGACATCAAAATCTCAGACTGCGTTCCAAACCAGCCGCACCCGTTTTCAATCAGAGCAAATTGGATCGGTTGCTGTTGATTGAGCTTCCAGGCTTTATAAAGAGGCAGAGCGGCAAAGCACGGAGAGAGTCCCTGTTTTCCCTAACCCAGTGATTATAGTGTGATAGAGATTATTGTTGGATATTGAGAACTGTGAGCTTGTGAATCTCGTGAGATTGTAGTGTAAATAAGTGTGACGTGTAACTTTATGTGACAAGTAAGCCGTGTA

Function


GO:

id name namespace
GO:0048731 system development biological_process
GO:0048468 cell development biological_process
GO:0061387 regulation of extent of cell growth biological_process
GO:0022610 biological adhesion biological_process
GO:0006935 chemotaxis biological_process
GO:0030154 cell differentiation biological_process
GO:0030433 ubiquitin-dependent ERAD pathway biological_process
GO:0048513 animal organ development biological_process
GO:0000902 cell morphogenesis biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:0098609 cell-cell adhesion biological_process
GO:0030182 neuron differentiation biological_process
GO:1990138 neuron projection extension biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0007275 multicellular organism development biological_process
GO:0019857 5-methylcytosine metabolic process biological_process
GO:0120035 regulation of plasma membrane bounded cell projection organization biological_process
GO:0120036 plasma membrane bounded cell projection organization biological_process
GO:0120039 plasma membrane bounded cell projection morphogenesis biological_process
GO:0051239 regulation of multicellular organismal process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0030516 regulation of axon extension biological_process
GO:0048856 anatomical structure development biological_process
GO:0048858 cell projection morphogenesis biological_process
GO:0048588 developmental cell growth biological_process
GO:0048589 developmental growth biological_process
GO:0001558 regulation of cell growth biological_process
GO:0048869 cellular developmental process biological_process
GO:0045595 regulation of cell differentiation biological_process
GO:2000026 regulation of multicellular organismal development biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0032990 cell part morphogenesis biological_process
GO:0010769 regulation of cell morphogenesis involved in differentiation biological_process
GO:0040007 growth biological_process
GO:0048638 regulation of developmental growth biological_process
GO:0040008 regulation of growth biological_process
GO:0021952 central nervous system projection neuron axonogenesis biological_process
GO:0021954 central nervous system neuron development biological_process
GO:0006211 5-methylcytosine catabolic process biological_process
GO:0021955 central nervous system neuron axonogenesis biological_process
GO:0050770 regulation of axonogenesis biological_process
GO:0097485 neuron projection guidance biological_process
GO:0006516 glycoprotein catabolic process biological_process
GO:0071711 basement membrane organization biological_process
GO:0061564 axon development biological_process
GO:0030030 cell projection organization biological_process
GO:0048666 neuron development biological_process
GO:0050793 regulation of developmental process biological_process
GO:0048667 cell morphogenesis involved in neuron differentiation biological_process
GO:0007399 nervous system development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process biological_process
GO:0032502 developmental process biological_process
GO:0048675 axon extension biological_process
GO:0007409 axonogenesis biological_process
GO:0007411 axon guidance biological_process
GO:0045664 regulation of neuron differentiation biological_process
GO:0042330 taxis biological_process
GO:0007417 central nervous system development biological_process
GO:0060560 developmental growth involved in morphogenesis biological_process
GO:0022008 neurogenesis biological_process
GO:0048699 generation of neurons biological_process
GO:0008361 regulation of cell size biological_process
GO:0031175 neuron projection development biological_process
GO:0007155 cell adhesion biological_process
GO:0016049 cell growth biological_process
GO:0019005 SCF ubiquitin ligase complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0048495 Roundabout binding molecular_function
GO:0070579 methylcytosine dioxygenase activity molecular_function
GO:0061630 ubiquitin protein ligase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-061009-32 Predicted to contribute to ubiquitin protein ligase activity. Predicted to be involved in SCF-dependent proteasomal ubiquitin-dependent protein catabolic process; glycoprotein catabolic process; and ubiquitin-dependent ERAD pathway. Predicted to be part of SCF ubiquitin ligase complex. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDART00000139286

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00044801 lncRNA upstream 99603 16798100 ~ 16798722 (+) True XLOC_021561
TCONS_00044667 lncRNA upstream 490899 16406558 ~ 16407426 (+) True XLOC_021554
TCONS_00044666 lncRNA upstream 618831 16272565 ~ 16279494 (+) True XLOC_021552
TCONS_00044665 lncRNA upstream 629587 16267497 ~ 16268738 (+) True XLOC_021551
TCONS_00044800 lncRNA upstream 649088 16227564 ~ 16249237 (+) True XLOC_021550
TCONS_00044804 lncRNA downstream 245309 17146315 ~ 17211274 (+) False XLOC_021571
TCONS_00044668 lncRNA downstream 353492 17254498 ~ 17254757 (+) True XLOC_021573
TCONS_00044805 lncRNA downstream 511519 17412525 ~ 17421436 (+) False XLOC_021576
TCONS_00044806 lncRNA downstream 572113 17473119 ~ 17477448 (+) True XLOC_021578
TCONS_00042840 lncRNA downstream 641713 17542719 ~ 17546078 (+) False XLOC_021580
TCONS_00042813 mRNA upstream 14227 16864130 ~ 16884098 (+) True XLOC_021566
TCONS_00042810 mRNA upstream 43836 16823385 ~ 16854489 (+) False XLOC_021564
TCONS_00042811 mRNA upstream 48810 16831063 ~ 16849515 (+) True XLOC_021564
TCONS_00042807 mRNA upstream 75063 16814968 ~ 16823262 (+) False XLOC_021563
TCONS_00042809 mRNA upstream 75466 16815374 ~ 16822859 (+) True XLOC_021563
TCONS_00042819 mRNA downstream 7006 16908012 ~ 16918191 (+) False XLOC_021567
TCONS_00042820 mRNA downstream 9065 16910071 ~ 16917948 (+) True XLOC_021567
TCONS_00042821 mRNA downstream 27500 16928506 ~ 16937530 (+) False XLOC_021568
TCONS_00042822 mRNA downstream 27505 16928511 ~ 16937449 (+) False XLOC_021568
TCONS_00042823 mRNA downstream 34488 16935494 ~ 16938403 (+) False XLOC_021568
TCONS_00042812 other upstream 39292 16858917 ~ 16859033 (+) True XLOC_021565
TCONS_00042792 other upstream 452285 16444961 ~ 16446040 (+) True XLOC_021556
TCONS_00042790 other upstream 541096 16356708 ~ 16357229 (+) True XLOC_021553
TCONS_00042789 other upstream 1146779 15750018 ~ 15751546 (+) True XLOC_021546
TCONS_00042786 other upstream 1545076 15353133 ~ 15353249 (+) True XLOC_021542
TCONS_00042824 other downstream 36623 16937629 ~ 16945441 (+) True XLOC_021568
TCONS_00042827 other downstream 245309 17146315 ~ 17146991 (+) False XLOC_021571
TCONS_00042828 other downstream 245555 17146561 ~ 17211274 (+) False XLOC_021571
TCONS_00042829 other downstream 286878 17187884 ~ 17211806 (+) True XLOC_021571
TCONS_00042836 other downstream 600308 17501314 ~ 17501428 (+) True XLOC_021579

Expression Profile


//