RNA id: TCONS_00043425


Basic Information

Item Value
RNA id TCONS_00043425
length 268
RNA type mRNA
GC content 0.45
exon number 3
gene id XLOC_021928
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 39963599 ~ 40043212 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAGTCAGATCCAGAGGATTATCAGAGATCTGCGCGATGCTGTTTCCGAACTGACAAAGGAGTATAAAGAGAGCGGTGAGCCCATTACTGATGACAGCTCCAATCTGCACAAGTTCTCCTACAAGCTGGAGTATCTGCTTCAGTTCGACCAAAAGGAGAAAACAACATTTCTGGGCTCCAGAAAAGACTACTGGGATTACTTCAGCGACTGCCTGGCCAAAATCAAAGGAGCAAATGATGGAATTCGCTTCGTTAAATCAATTTCAGAG

Function

GO:

id name namespace
GO:0072383 plus-end-directed vesicle transport along microtubule biological_process
GO:1901098 positive regulation of autophagosome maturation biological_process
GO:0005764 lysosome cellular_component
GO:0005770 late endosome cellular_component
GO:0005776 autophagosome cellular_component
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-110411-276 Predicted to enable metal ion binding activity. Predicted to be involved in plus-end-directed vesicle transport along microtubule and positive regulation of autophagosome maturation. Predicted to be active in autophagosome; late endosome; and lysosome. Human ortholog(s) of this gene implicated in cataract 18. Orthologous to human FYCO1 (FYVE and coiled-coil domain autophagy adaptor 1).

Ensembl:

ensembl_id ENSDART00000165376

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00044694 lncRNA upstream 217461 39752488 ~ 39752964 (+) True XLOC_021926
TCONS_00043420 lncRNA upstream 251591 39714649 ~ 39718834 (+) True XLOC_021925
TCONS_00043411 lncRNA upstream 480074 39462206 ~ 39490351 (+) False XLOC_021921
TCONS_00043408 lncRNA upstream 544629 39347185 ~ 39425796 (+) False XLOC_021920
TCONS_00043402 lncRNA upstream 786116 39183246 ~ 39184309 (+) True XLOC_021918
TCONS_00044898 lncRNA downstream 550314 40524394 ~ 40526983 (+) True XLOC_021937
TCONS_00044899 lncRNA downstream 840663 40814743 ~ 40815221 (+) True XLOC_021940
TCONS_00044900 lncRNA downstream 884120 40858200 ~ 40866526 (+) True XLOC_021941
TCONS_00044695 lncRNA downstream 1030952 41005032 ~ 41019226 (+) True XLOC_021944
TCONS_00043444 lncRNA downstream 1047431 41021511 ~ 41033851 (+) False XLOC_021945
TCONS_00043423 mRNA upstream 29400 39854596 ~ 39941025 (+) True XLOC_021927
TCONS_00043422 mRNA upstream 36898 39854566 ~ 39933527 (+) False XLOC_021927
TCONS_00043421 mRNA upstream 36898 39854566 ~ 39933527 (+) False XLOC_021927
TCONS_00043417 mRNA upstream 243078 39695827 ~ 39727347 (+) False XLOC_021925
TCONS_00043426 mRNA downstream 135273 40109353 ~ 40126859 (+) True XLOC_021929
TCONS_00043427 mRNA downstream 159056 40133136 ~ 40186528 (+) False XLOC_021930
TCONS_00043428 mRNA downstream 165685 40139765 ~ 40185999 (+) True XLOC_021930
TCONS_00043429 mRNA downstream 301320 40275400 ~ 40283071 (+) False XLOC_021931
TCONS_00043430 mRNA downstream 301521 40275601 ~ 40286059 (+) True XLOC_021931
TCONS_00043391 other upstream 1634541 38335760 ~ 38335884 (+) True XLOC_021913
TCONS_00043382 other upstream 1875865 38092005 ~ 38094560 (+) False XLOC_021909
TCONS_00043383 other upstream 1876261 38092010 ~ 38094164 (+) False XLOC_021909
TCONS_00043378 other upstream 2115803 37851830 ~ 37854622 (+) True XLOC_021906
TCONS_00043376 other upstream 2202269 37750334 ~ 37768156 (+) True XLOC_021904
TCONS_00043431 other downstream 332164 40306244 ~ 40306371 (+) True XLOC_021932
TCONS_00043437 other downstream 492422 40466502 ~ 40472088 (+) True XLOC_021935
TCONS_00043438 other downstream 503140 40477220 ~ 40480582 (+) True XLOC_021936
TCONS_00043441 other downstream 778624 40752704 ~ 40752818 (+) True XLOC_021939
TCONS_00043458 other downstream 2217159 42191239 ~ 42191353 (+) True XLOC_021959

Expression Profile

//