RNA id: TCONS_00045597


Basic Information

Item Value
RNA id TCONS_00045597
length 117
RNA type miRNA
GC content 0.50
exon number 1
gene id XLOC_022952
representative True

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 24453041 ~ 24458446 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCTCTGTGGGATTTCAGACTCTGGCTTTCCGTGTTCACAGCGGACCTTGATTTAATGTCTTACAATTAAGGCACGCGGTGAATGCCAAGAGCGGAGCCTTTTAACATCAGCAGGCC

Function

GO:

id name namespace
GO:0050877 nervous system process biological_process
GO:0043010 camera-type eye development biological_process
GO:0050953 sensory perception of light stimulus biological_process
GO:0002088 lens development in camera-type eye biological_process
GO:0007600 sensory perception biological_process
GO:0007601 visual perception biological_process
GO:0048880 sensory system development biological_process
GO:0001654 eye development biological_process
GO:0007423 sensory organ development biological_process
GO:0150063 visual system development biological_process
GO:0043005 neuron projection cellular_component
GO:0120025 plasma membrane bounded cell projection cellular_component
GO:0045202 synapse cellular_component
GO:0097458 obsolete neuron part cellular_component
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000116338

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00047000 lncRNA upstream 244291 24203606 ~ 24211341 (+) True XLOC_022950
TCONS_00046998 lncRNA upstream 442534 23973784 ~ 24013098 (+) True XLOC_022944
TCONS_00046999 lncRNA upstream 469797 23982487 ~ 23985835 (+) True XLOC_022945
TCONS_00045590 lncRNA upstream 478143 23973784 ~ 23977489 (+) False XLOC_022944
TCONS_00046997 lncRNA upstream 518744 23935071 ~ 23936888 (+) True XLOC_022943
TCONS_00045602 lncRNA downstream 271244 24726992 ~ 24730970 (+) True XLOC_022954
TCONS_00047003 lncRNA downstream 483009 24938757 ~ 24942201 (+) True XLOC_022958
TCONS_00045607 lncRNA downstream 527387 24983135 ~ 24993102 (+) True XLOC_022959
TCONS_00047004 lncRNA downstream 629390 25085138 ~ 25087075 (+) True XLOC_022962
TCONS_00047005 lncRNA downstream 688427 25144175 ~ 25184614 (+) False XLOC_022963
TCONS_00045596 mRNA upstream 155282 24285751 ~ 24300350 (+) True XLOC_022951
TCONS_00045595 mRNA upstream 277991 24170914 ~ 24177641 (+) True XLOC_022949
TCONS_00045594 mRNA upstream 354500 24086491 ~ 24101132 (+) True XLOC_022948
TCONS_00045593 mRNA upstream 354649 24086249 ~ 24100983 (+) False XLOC_022948
TCONS_00045592 mRNA upstream 384608 24064562 ~ 24071024 (+) True XLOC_022947
TCONS_00045598 mRNA downstream 5593 24461341 ~ 24463346 (+) True XLOC_022953
TCONS_00045599 mRNA downstream 271208 24726956 ~ 24729124 (+) False XLOC_022954
TCONS_00045601 mRNA downstream 271223 24726971 ~ 24733255 (+) False XLOC_022954
TCONS_00045603 mRNA downstream 353207 24808955 ~ 24824899 (+) False XLOC_022955
TCONS_00045604 mRNA downstream 354129 24809877 ~ 24824696 (+) True XLOC_022955
TCONS_00045587 other upstream 523107 23841684 ~ 23932525 (+) True XLOC_022942
TCONS_00045578 other upstream 1366127 23089389 ~ 23089505 (+) True XLOC_022933
TCONS_00045572 other upstream 1998671 22456844 ~ 22456961 (+) True XLOC_022929
TCONS_00045565 other upstream 2706932 21720480 ~ 21748700 (+) False XLOC_022923
TCONS_00045559 other upstream 2825792 21629725 ~ 21629840 (+) True XLOC_022919
TCONS_00045600 other downstream 271210 24726958 ~ 24730970 (+) False XLOC_022954
TCONS_00045636 other downstream 1729662 26185410 ~ 26185500 (+) True XLOC_022980
TCONS_00045637 other downstream 1734804 26190552 ~ 26190634 (+) True XLOC_022981
TCONS_00045660 other downstream 2567761 27023509 ~ 27030978 (+) False XLOC_022994
TCONS_00045667 other downstream 2956391 27412139 ~ 27412253 (+) True XLOC_022998

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
rainbow trout (Oncorhynchus mykiss) TU1080552 False 289 lncRNA 0.43 2 NC_048575.1 15096177 ~ 15158908 (-)
eurasian perch (Perca fluviatilis) TU297713 False 1069 lncRNA 0.43 3 NC_053133.1 15773679 ~ 15776903 (-)