RNA id: TCONS_00007953


Basic Information

Item Value
RNA id TCONS_00007953
length 787
RNA type mRNA
GC content 0.47
exon number 6
gene id XLOC_004161
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 26568492 ~ 26590429 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAAGCTTGACATCATTTCTCCTCAGTACATGCAATAGTGGGTTCTGCGTTTACTCGCCCACAGTCGGTAGCGGAGAGCAGGGCGTCTCTGCAGGCATCTGATGGAACGATTAAAGACGTCACTCAGAAGATGTTTAAGATAATTTCCCCTCCACATGAGGATGAAACACCACGGCAGAACCAGTGCCGGAAGTGTGCAGTTGTTGGGAACTCGGGGAACCTGTTAAAGTCCAAATATGGAGCCTTGATAGATTCTCACTCAACAGTTATTAGAATGAATAAGGCTGTAACTGTGGGTTATGACGAGGATGTTGGTAACCGAACCACCCACCACTTCTTGTACCCAGAGAGCGCCATCAATCTAAGACCTGGAGTCCATCTCGTCCTTCTTCCCTTCAAGCTGAAAGACATGCAGTGGTTGTCCAGCGCCCTTTCTACTGGAGAGATTAAAATGACGTACATGAGAGTGAAAAACCGTATAGACGCTGATAAAGACAAGGTGATGGTCGTAAATCCAGCTTTCTTTAAGTACACACACGACAAGTGGACAGAGCGTCATGGAAGATACCCGTCCACTGGGATAGTAGCCATAATATTTGCTCTGCATCTCTGTGACGAGGTGTCAGTGTTTGGATACGGGGCGGACGCTCAAGGAAATTGGCACCACTATTGGGAGTACAACAGATACGCAGGTGCCTTTCGAAAAACAGGCGTTCACAATGCTGATTTCGAGACTGAGATCATTCAGAGACTCAGCGCAGAGGGCAAAATCAAGCTGTACAGATGAG

Function

GO:

id name namespace
GO:0006486 protein glycosylation biological_process
GO:0005794 Golgi apparatus cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016740 transferase activity molecular_function
GO:0016757 transferase activity, transferring glycosyl groups molecular_function
GO:0003836 beta-galactoside (CMP) alpha-2,3-sialyltransferase activity molecular_function
GO:0008373 sialyltransferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050417-286 Predicted to enable beta-galactoside (CMP) alpha-2,3-sialyltransferase activity. Predicted to act upstream of or within protein glycosylation. Predicted to be located in Golgi apparatus and membrane. Predicted to be integral component of membrane. Is expressed in several structures, including brain; cardiovascular system; paraxial mesoderm; pectoral fin; and pleuroperitoneal region. Orthologous to human ST3GAL2 (ST3 beta-galactoside alpha-2,3-sialyltransferase 2).

Ensembl:

ensembl_id ENSDART00000123094

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008798 lncRNA downstream 1091867 25475305 ~ 25476980 (-) False XLOC_004150
TCONS_00007926 lncRNA downstream 1091867 25475305 ~ 25476980 (-) False XLOC_004150
TCONS_00008797 lncRNA downstream 1092265 25475305 ~ 25476582 (-) False XLOC_004150
TCONS_00007924 lncRNA downstream 1155694 25412343 ~ 25413153 (-) True XLOC_004148
TCONS_00007921 lncRNA downstream 1159951 25368112 ~ 25408896 (-) False XLOC_004147
TCONS_00008799 lncRNA upstream 29005 26619434 ~ 26666495 (-) False XLOC_004162
TCONS_00007965 lncRNA upstream 911776 27502205 ~ 27507973 (-) False XLOC_004167
TCONS_00007962 lncRNA upstream 912080 27502509 ~ 27503132 (-) False XLOC_004167
TCONS_00008800 lncRNA upstream 953149 27543578 ~ 27625465 (-) False XLOC_004169
TCONS_00007969 lncRNA upstream 1002214 27592643 ~ 27625125 (-) False XLOC_004169
TCONS_00007949 mRNA downstream 193272 26370381 ~ 26375575 (-) False XLOC_004160
TCONS_00007946 mRNA downstream 206513 26228918 ~ 26362334 (-) False XLOC_004159
TCONS_00007947 mRNA downstream 206553 26232146 ~ 26362294 (-) False XLOC_004159
TCONS_00007944 mRNA downstream 351337 26189703 ~ 26217510 (-) False XLOC_004158
TCONS_00007955 mRNA upstream 28704 26619133 ~ 26666627 (-) False XLOC_004162
TCONS_00007956 mRNA upstream 72195 26662624 ~ 26666501 (-) True XLOC_004162
TCONS_00007957 mRNA upstream 95553 26685982 ~ 26701611 (-) True XLOC_004163
TCONS_00007958 mRNA upstream 113752 26704181 ~ 27057572 (-) False XLOC_004164
TCONS_00007959 mRNA upstream 116833 26707262 ~ 26832685 (-) True XLOC_004164
TCONS_00007950 other downstream 193329 26373998 ~ 26375518 (-) True XLOC_004160
TCONS_00007948 other downstream 330894 26233727 ~ 26237953 (-) True XLOC_004159
TCONS_00007943 other downstream 388133 26020099 ~ 26180714 (-) True XLOC_004157
TCONS_00007940 other downstream 637765 25857941 ~ 25931082 (-) False XLOC_004157
TCONS_00007931 other downstream 898892 25669839 ~ 25669955 (-) True XLOC_004152
TCONS_00007960 other upstream 157863 26748292 ~ 26748429 (-) True XLOC_004165
TCONS_00007963 other upstream 912588 27503017 ~ 27503132 (-) False XLOC_004167
TCONS_00007964 other upstream 912803 27503232 ~ 27503320 (-) True XLOC_004167
TCONS_00007974 other upstream 1123035 27713464 ~ 27719269 (-) True XLOC_004171
TCONS_00007992 other upstream 1487719 28078148 ~ 28086924 (-) False XLOC_004178

Expression Profile

//