G240254



Basic Information


Item Value
gene id G240254
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 5557617 ~ 5557831 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU272618
GAAAGTGAACTAATCCTTTAACCTAAAAATAGCCTATTTAATATTTGAAGTTTAATTTAAATACTTAATATTTATCTTTTGGTATTTAGACCTAATTAGAAACATGGGATAAGATGATAAAAATGATATTTTACTGAAATTCTACTTTGTCTGTCATTGGTTATTCAATTATTATCAACTAAATTGTCAAAATAAAATTGTAAATAGTAGTATTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU272618 True 215 lncRNA 0.21 1 5557617 5557831

Neighbor


gene id symbol gene type direction distance location
CI01000055_05517350_05524400 NA coding upstream 32997 5517350 ~ 5524620 (+)
CI01000055_05263543_05300250 TMTC3 coding upstream 256968 5263247 ~ 5300649 (+)
CI01000055_05216403_05221104 NA coding upstream 336447 5216200 ~ 5221170 (+)
CI01000055_05212820_05215358 BORCS5 coding upstream 341474 5211471 ~ 5216143 (+)
CI01000055_05183333_05195895 BTBD10B, BTBD10, BTBD10A coding upstream 361047 5183333 ~ 5196570 (+)
CI01000055_05565166_05572215 TES coding downstream 7335 5565166 ~ 5572457 (+)
CI01000055_05608414_05611862 CAV2 coding downstream 49675 5607506 ~ 5613775 (+)
CI01000055_05614889_05616453 NA coding downstream 56234 5614065 ~ 5617591 (+)
CI01000055_05630944_05688603 MET coding downstream 73113 5630944 ~ 5688603 (+)
CI01000055_05693578_05697926 FAM185A coding downstream 135683 5693514 ~ 5698294 (+)
G240252 NA non-coding upstream 941 5555646 ~ 5556676 (+)
G240251 NA non-coding upstream 4869 5551169 ~ 5552748 (+)
G240250 NA non-coding upstream 6893 5550375 ~ 5550724 (+)
G240249 NA non-coding upstream 7434 5549832 ~ 5550183 (+)
G240248 NA non-coding upstream 9146 5548246 ~ 5548471 (+)
G240255 NA non-coding downstream 5308 5563139 ~ 5563936 (+)
G240221 NA non-coding downstream 64986 5622817 ~ 5623356 (+)
G240286 NA non-coding downstream 195125 5752956 ~ 5753173 (+)
G240290 NA non-coding downstream 211621 5769452 ~ 5769880 (+)
G240099 NA other upstream 13805 5525472 ~ 5544153 (+)
CI01000055_05163240_05166231 PIGY, PYURF other upstream 390970 5162990 ~ 5166647 (+)
CI01000055_04265119_04272728 NA other upstream 1284902 4265119 ~ 4273913 (+)
G239755 NA other upstream 1302525 4254210 ~ 4255092 (+)
G239761 NA other upstream 1344215 4162250 ~ 4213402 (+)
CI01000055_06087070_06088629 ETFRF1, LYRM5, LYRM5B other downstream 528994 6087034 ~ 6088759 (+)
G240344 NA other downstream 606029 6163860 ~ 6164011 (+)
CI01000055_06310117_06334586 GRAMD4B, GRAMD4 other downstream 776493 6310117 ~ 6334801 (+)

Expression



Co-expression Network