G439841


Basic Information

Item Value
gene id G439841
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000310
NCBI id null
chromosome length 5141163
location 1897560 ~ 1898250 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU504911
CCGTGTCTGAGTGAACTCCGATGATTGGTCTAAGGGGAGAAGCTTGAAATCTCACACTCCTTCCTGGATCCATGAGGGTCCTGTGCTGATAAGACCCCCTCCGTGGAGACACGGCCCTGAGCACCCCTTTTTGTCGACCCAGCGGAGACTGTGCTCGCTGTCCCGATGGGTCTGAACCTGTAGGTCTTACAGGTGACAGCTGCCGGACGGGTGAAAAATCCCCTCTGATGCTCAGATCTCTCCTTGGAGAAATGGCTCTTAAAGGAGACAAATCACGGCATGACAACGGGTGACATTGCGGCGAGAGATTACCTCTTGGGGATATGTACCGCTGGCGAGGTGAATCCCAACAAGGCGACAGCAGGTGAGGTGGGCAAGACTCAAAGGAGCTGCTGGACTGCTCAAAGGTCAGATCATCCTCAAGACTCTGAGAGGAAACTTCAAGCTGTTCCTTCGGTAGATTGCGGTTTGGGTCAAAGTGTTTAGGGAGACAGCCAGACAGACATGGCTTGTTGACTGCATAGGACTGAGGACTTGTGCTTCTGGACAGCGTTTTTGGTGTAGAATCACCATCACATTCATCATCTTCATCATCGTCTGGTTCATCATCATCGACCCCATCAGAGTCTTCCACATCTGAGAACTGATGTTTAATGGTTGTTTCCAATGGCATGATGCCAGAGGACTTCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU504911 True 691 lncRNA 0.51 1 1897560 1898250

Neighbor

gene id symbol gene type direction distance location
CI01000310_01887698_01893727 CX23, GJE1 coding upstream 3720 1887300 ~ 1893840 (+)
CI01000310_01814975_01815586 DUS23, DUSP23B, DUSP23, TP53I3 coding upstream 81904 1814975 ~ 1815656 (+)
CI01000310_01737635_01745606 CHRNA2A, CHRNA2 coding upstream 151873 1737635 ~ 1745687 (+)
CI01000310_01723036_01723254 NA coding upstream 174010 1723036 ~ 1723550 (+)
CI01000310_01693209_01696414 NA coding upstream 200689 1692729 ~ 1696871 (+)
CI01000310_01941915_01945313 TATDN3 coding downstream 43665 1941915 ~ 1945642 (+)
CI01000310_01947567_01956704 ADCK3 coding downstream 49317 1947567 ~ 1956760 (+)
CI01000310_01981356_01982015 NA coding downstream 82725 1980975 ~ 1982224 (+)
CI01000310_01992187_02003475 SLC5A6B coding downstream 93390 1991640 ~ 2003475 (+)
CI01000310_02017340_02026116 NA coding downstream 119090 2017340 ~ 2026116 (+)
G439842 NA non-coding upstream 599 1894708 ~ 1896961 (+)
G439790 NA non-coding upstream 35246 1861838 ~ 1862314 (+)
G439788 NA non-coding upstream 41360 1855802 ~ 1856200 (+)
G439760 NA non-coding upstream 75295 1820365 ~ 1822265 (+)
G439764 NA non-coding upstream 78301 1818893 ~ 1819259 (+)
G439843 NA non-coding downstream 1116 1899366 ~ 1903564 (+)
G439844 NA non-coding downstream 6519 1904769 ~ 1905180 (+)
G439846 NA non-coding downstream 7715 1905965 ~ 1906387 (+)
G439847 NA non-coding downstream 9113 1907363 ~ 1908032 (+)
G439849 NA non-coding downstream 15855 1914105 ~ 1914426 (+)
CI01000310_01508712_01511125 FAM167A other upstream 384219 1508341 ~ 1513341 (+)
CI01000310_01207513_01226750 CDC5L other upstream 658155 1207057 ~ 1227194 (+)
G439115 NA other upstream 1206368 651976 ~ 653356 (+)
CI01000310_00648731_00650082 NAPB other upstream 1248007 648566 ~ 650159 (+)
G439845 NA other downstream 13351 1911601 ~ 1912417 (+)
G440505 NA other downstream 1201167 3099417 ~ 3136328 (+)

Expression


Co-expression Network