G679202


Basic Information

Item Value
gene id G679202
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 2098541 ~ 2098808 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799899
GGTTGAGACCAAGACAAGGCCAAGACTTTGTGGGTTTGAGACCAAGACAAGACCAAGACTTTGAGGGTTTGAGACCAAGATAAGACCAAGACTTTGAGGGGTTGAGACCAAGACAAGGCCAAGACTTTGTGGGTTTGAGACCAAGACAAGACCAAGACAAGACTTTGAGGGGTTGAGACCAAGACAAGATCAAGGCCAGAATAAAAAATAAAAAAACAAGATACTAAAAAGCACTTTTTTGCAATCATATCTTAAATTTTTGTGGGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU799899 True 268 lncRNA 0.41 1 2098541 2098808

Neighbor

gene id symbol gene type direction distance location
CI01180000_01942458_01949580 NA coding upstream 147894 1942127 ~ 1950647 (+)
CI01180000_01915282_01926129 NA coding upstream 172272 1914892 ~ 1926269 (+)
CI01180000_01865632_01870994 NA coding upstream 227452 1865509 ~ 1871089 (+)
CI01180000_01832263_01834405 COX5B.2, COX5B2, COX5B coding upstream 263542 1832013 ~ 1834999 (+)
CI01180000_01828938_01830221 DNAJC12 coding upstream 267727 1828938 ~ 1830814 (+)
CI01180000_02158036_02158965 HS3ST1L1 coding downstream 58542 2157350 ~ 2159222 (+)
CI01180000_02322594_02323609 NA coding downstream 221544 2320352 ~ 2323752 (+)
CI01180000_02362001_02362428 NA coding downstream 263152 2361960 ~ 2363530 (+)
CI01180000_02541296_02567509 CFAP46 coding downstream 442488 2541296 ~ 2567783 (+)
CI01180000_02574027_02588521 NA coding downstream 475219 2574027 ~ 2588824 (+)
G679165 NA non-coding upstream 37530 2051527 ~ 2061011 (+)
G679160 NA non-coding upstream 67510 2030738 ~ 2031031 (+)
G679080 NA non-coding upstream 289401 1808882 ~ 1809140 (+)
G679077 NA non-coding upstream 290486 1803405 ~ 1808055 (+)
G679072 NA non-coding upstream 318843 1778590 ~ 1779698 (+)
G679204 NA non-coding downstream 890 2099698 ~ 2106093 (+)
G679050 NA non-coding downstream 22461 2121269 ~ 2127987 (+)
G679228 NA non-coding downstream 98381 2197189 ~ 2201435 (+)
G679218 NA non-coding downstream 111981 2210789 ~ 2214934 (+)
G679047 NA non-coding downstream 139682 2238490 ~ 2241873 (+)
G679076 NA other upstream 299108 1795170 ~ 1799433 (+)
G678946 NA other upstream 542390 1518353 ~ 1612547 (+)
G678637 NA other upstream 942869 1149551 ~ 1155672 (+)
G678751 NA other upstream 1032450 1059843 ~ 1066091 (+)
G678440 NA other upstream 1946889 147934 ~ 151652 (+)
G679324 NA other downstream 290059 2388867 ~ 2397360 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other downstream 590954 2689271 ~ 2693221 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other downstream 1454469 3569165 ~ 3573135 (+)
G680736 NA other downstream 1666883 3765691 ~ 3784441 (+)
G681137 NA other downstream 2684497 4783305 ~ 4785631 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) G150170 NA non-coding NC_053125.1 CM020922.1 38497665 ~ 38501382 (-)