G682988


Basic Information

Item Value
gene id G682988
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 4410263 ~ 4410482 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU804179
CTGAACTGGTACAGTGTGTATCCCACCCACAGTGTGCCCAGCATGAGGAGAAGACAGAGTAGCGGCCGTGCCCGTGTGCACAGAATGAAGGATTCTGGGAGGGACACGGGCCCTGCCTCTGTCAAGTTCAATTCCCCTAAATGTACACTTCCACTGATGCGATTCAGCTCTGCCGCACTCCCATTGGCCAAAGTGGGAGCATGATAGTACTCGTGAAAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU804179 True 220 lncRNA 0.54 1 4410263 4410482

Neighbor

gene id symbol gene type direction distance location
CI01180000_04327538_04335433 NA coding downstream 73874 4327360 ~ 4336389 (-)
CI01180000_04131891_04133055 NA coding downstream 277127 4130958 ~ 4133136 (-)
CI01180000_04082957_04114030 FGFR3 coding downstream 296233 4082648 ~ 4114030 (-)
CI01180000_03983803_04002213 WHSC1 coding downstream 407608 3983486 ~ 4002655 (-)
CI01180000_03824786_03831186 ADH8A coding downstream 579077 3824669 ~ 3831186 (-)
CI01180000_04554549_04560819 NA coding upstream 142959 4553441 ~ 4561772 (-)
CI01180000_04567468_04575805 GFRA4, GFRA4A coding upstream 156753 4567235 ~ 4575805 (-)
CI01180000_04780398_04786371 AP5S1 coding upstream 369416 4779898 ~ 4786371 (-)
CI01180000_04790491_04793557 NA coding upstream 379056 4789538 ~ 4793664 (-)
CI01180000_04796238_04797552 NA coding upstream 385694 4796176 ~ 4797842 (-)
G682982 NA non-coding downstream 17558 4392426 ~ 4392705 (-)
G682981 NA non-coding downstream 19921 4390062 ~ 4390342 (-)
G682980 NA non-coding downstream 20888 4389128 ~ 4389375 (-)
G682979 NA non-coding downstream 22041 4387953 ~ 4388222 (-)
G682977 NA non-coding downstream 23409 4386154 ~ 4386854 (-)
G682987 NA non-coding upstream 3162 4413644 ~ 4416875 (-)
G682986 NA non-coding upstream 7526 4418008 ~ 4420032 (-)
G682989 NA non-coding upstream 17649 4428131 ~ 4429475 (-)
G683022 NA non-coding upstream 134489 4544971 ~ 4546899 (-)
G683135 NA non-coding upstream 329028 4739510 ~ 4739998 (-)
CI01180000_03242704_03242928 YPEL5 other downstream 1165306 3241341 ~ 3242929 (-)
CI01180000_03016426_03018342 NA other downstream 1390588 3014433 ~ 3018343 (-)
CI01180000_02988807_02995955 NA other downstream 1416399 2987081 ~ 2997401 (-)
G680506 NA other downstream 1558347 2771047 ~ 2851916 (-)
G680525 NA other downstream 1793507 2616354 ~ 2616756 (-)
G683394 NA other upstream 1207725 5618207 ~ 5619271 (-)
G683294 NA other upstream 1340562 5751044 ~ 5755526 (-)
G683673 NA other upstream 2351593 6762075 ~ 6762844 (-)
G684018 NA other upstream 2992665 7403147 ~ 7413132 (-)

Expression


Co-expression Network