XLOC_015733


Basic Information

Item Value
gene id XLOC_015733
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 37826734 ~ 37827039 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031330
GTAGCGGAAGGAAGCTCACTGTAGAGGTTACCCACTGAGTGCTCGTCACTCGCCAACACCTCGGGGAAGGTCTGAGACAGGAGCCACTCGCTGTCCTAGCAGGACATCATCTGAATGATGAGCGAGTGCACAGAAAATCGGGTCACGCGCGCGATTCTCGCAGCAGACGTTGATACTCGCACACATTCAGCGGATCAACTGATGCGACGCGCGCAGACTTGGAAACACTCGCGGCTGGCGAATGAGTGCGATGTGTGAGCTAGCATAACATGCTAGAACCCAATTCAGACTACTCTCCCTCCGCTC

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0050789 regulation of biological process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031330 True 306 lncRNA 0.56 1 37826734 37827039

Neighbor

gene id symbol gene type direction distance location
XLOC_015732 sdr39u1 coding upstream 2307 37815687 ~ 37824427 (+)
XLOC_015731 ltb4r2b coding upstream 14549 37804235 ~ 37812185 (+)
XLOC_015730 ftr66 coding upstream 56403 37762924 ~ 37770331 (+)
XLOC_015729 MYADM coding upstream 71606 37750016 ~ 37755128 (+)
XLOC_015728 sppl2 coding upstream 323725 37480669 ~ 37503009 (+)
XLOC_015734 AL954692.1 coding downstream 9580 37836619 ~ 37846849 (+)
XLOC_015735 cbln13 coding downstream 47732 37874771 ~ 37878304 (+)
XLOC_015736 tep1 coding downstream 70040 37897079 ~ 37906118 (+)
XLOC_015737 LO017954.1 coding downstream 99341 37926380 ~ 37927412 (+)
XLOC_015738 NA coding downstream 140946 37967985 ~ 37971044 (+)
XLOC_015725 NA non-coding upstream 519163 37301408 ~ 37307571 (+)
XLOC_015713 dre-mir-2198 non-coding upstream 1072976 36753649 ~ 36753758 (+)
XLOC_015712 NA non-coding upstream 1082822 36742343 ~ 36743912 (+)
XLOC_015707 NA non-coding upstream 1183972 36638931 ~ 36642762 (+)
XLOC_015705 NA non-coding upstream 1262261 36552692 ~ 36564473 (+)
XLOC_015740 NA non-coding downstream 147957 37974996 ~ 37990505 (+)
XLOC_015741 NA non-coding downstream 172740 37999779 ~ 38000194 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G34595 NA non-coding CI01000004 null 15697005 ~ 15700776 (-)