AMCG00007167 (LOC106587439,LOC106587479,LOC104919254)


Basic Information

Item Value
gene id AMCG00007167
gene name LOC106587439,LOC106587479,LOC104919254
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 5826625 ~ 5841867 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00007167
ATGATCCCAAGCGAGTTCACAACGCAGGATAAGGTGCCCTGCTCTGGTATGATCCAGAGGTGCACGCCAGTAAAGTACCATTACTCCTCCTCCACTCTTCCGCGGAACCTCCCCATCAACATCACCAAGACGATCCGTCAGGACGAGTGGCACGCGCTCCACTTGCGTCGCATGACAGCGGGCTTTATAGGAATGGCTGTGTCCATTATCCTCTTTGGCTGGATTATTGGCGTCCTCGGCTGCTGCAAGCAACACGATTTGATGCAGTACGTCGCCGGGCTGCTGTTTCTCATGGGAGGGACCTGCTGCATCATCTCCCTGTGCACCTGTGTGGCCGGCATCAACTTCGAACTATCCAGATACCCGCGCCACATGTACGGACTGCCCGAGGACATCAGCCACGGCTACGGCTGGTCCATGTTCTGTGCCTGGGGCGGGCTGGGCCTCACGCTGCTGGCTGGATTCCTGTGTACATTAGCCCCCTCGCTCAGCACCCCCCGCACAATGGTGCAAAAGCCGCGGCAGGAGAACGGCACCGTGTGA

Function

NR:

description
PREDICTED: transmembrane protein 178B-like, partial

GO:

id name namespace
GO:0005923 bicellular tight junction cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005198 structural molecule activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00007167 True 543 mRNA 0.59 4 5826625 5841867

Neighbor

gene id symbol gene type direction distance location
AMCG00007163 NA coding downstream 73654 5734674 ~ 5752971 (-)
AMCG00007162 NA coding downstream 133320 5692142 ~ 5693305 (-)
AMCG00007157 kbtbd4,LOC107738697,LOC107686314 coding downstream 149056 5674177 ~ 5677569 (-)
AMCG00007158 celf1,LOC106561939 coding downstream 198253 5613748 ~ 5628372 (-)
AMCG00007156 rapsn coding downstream 220757 5592874 ~ 5605868 (-)
AMCG00007168 LOC103364365,LOC108229046,LOC101064922 coding upstream 16984 5858851 ~ 5859267 (-)
AMCG00007170 NA coding upstream 30909 5872776 ~ 5896585 (-)
AMCG00007172 nr1h3,LOC107553099,LOC107689968,LOC107664377 coding upstream 239668 6081535 ~ 6088041 (-)
AMCG00007176 NA coding upstream 279835 6121702 ~ 6122376 (-)
AMCG00007177 NA coding upstream 515143 6357010 ~ 6372398 (-)
G21582 NA non-coding downstream 105083 5721263 ~ 5721542 (-)
G21550 NA non-coding downstream 264417 5559594 ~ 5562208 (-)
G21536 NA non-coding downstream 302948 5521615 ~ 5523677 (-)
G21537 prdm11,LOC106560765 non-coding downstream 307874 5517227 ~ 5518751 (-)
G21535 NA non-coding downstream 310654 5514986 ~ 5515971 (-)
G21646 NA non-coding upstream 73205 5915072 ~ 5988322 (-)
G21722 NA non-coding upstream 498912 6340779 ~ 6341171 (-)
G21739 NA non-coding upstream 677256 6519123 ~ 6519736 (-)
G21756 NA non-coding upstream 724350 6566217 ~ 6569739 (-)
G21786 NA non-coding upstream 793716 6635583 ~ 6638309 (-)
G21632 psmc3,prs6a,LOC107758446 other downstream 6341 5816809 ~ 5820284 (-)
G21429 NA other downstream 769219 5056787 ~ 5057406 (-)
G21426 NA other downstream 777105 5041659 ~ 5049520 (-)
AMCG00007091 ckap5,LOC108269026 other downstream 2325955 3476068 ~ 3500670 (-)
AMCG00007072 NA other downstream 3162976 2644905 ~ 2663649 (-)
AMCG00007173 madd other upstream 165773 6007640 ~ 6054064 (-)
AMCG00007201 NA other upstream 1482557 7324424 ~ 7342341 (-)
G21942 NA other upstream 1657580 7499447 ~ 7506875 (-)
G22200 NA other upstream 2551329 8393196 ~ 8396224 (-)
AMCG00007267 NA other upstream 3615621 9457488 ~ 9463337 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_033846 si:ch211-150g13.3 coding NC_007118.7 CM002891.2 32722227 ~ 32749591 (+)
grasscarp (Ctenopharyngodon idella) CI01000026_06698615_06712459 NA coding CI01000026 null 6698224 ~ 6712852 (+)