AMCG00021260 (diaph2)



Basic Information


Item Value
gene id AMCG00021260
gene name diaph2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 12910567 ~ 12916125 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00021260
ATGCACAAGGAAAGGTTACCGTTTCTAGAGAAGAACCTGATCAAAAACCTGCCAGAGCAGAAAGAGCTGAGTGCACTGGCAGAGCTGAAAAGCGAATACGAGGAGCTGTGTGAGTCGGAGCAGTTTGGGATTGTGATGAGCTCAGTGAAGCTTCTTAGATCACGCCTCAATGGGATCCTGTTCAAGCTGACCTTCGAGGAGCAAGTCAACAATATCCGCCCTGATATCATGAATGTGACGTTTGCCTGTGAGGAGGTGAAGAGGAGTGAGGGCTTTAGCCGCCTGTTGGAGATGGTGTTGCTGGTGGGGAACTACATGAATGCCGGCTCCCGCAATGCACAGACCTTTGGCTTCAACATCAGCTTCCTCTGCAAGGTACTGTGA

Function


symbol description
diaph2 Predicted to enable actin binding activity. Acts upstream of or within cytoskeleton organization; gastrulation; and regulation of small GTPase mediated signal transduction. Is expressed in head. Human ortholog(s) of this gene implicated in primary ovarian insufficiency and primary ovarian insufficiency 2A. Orthologous to human DIAPH2 (diaphanous related formin 2).

NR:

description
PREDICTED: protein diaphanous homolog 2 isoform X6

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00021260 True 384 mRNA 0.51 3 12910567 12916125

Neighbor


gene id symbol gene type direction distance location
AMCG00021257 NA coding downstream 686259 12207338 ~ 12224308 (-)
AMCG00021252 NA coding downstream 779630 12127083 ~ 12130937 (-)
AMCG00021253 rab33a,LOC106611995,LOC107733314,LOC107666192,LOC107730569 coding downstream 783722 12122220 ~ 12126845 (-)
AMCG00021251 enox2 coding downstream 978770 11884997 ~ 11931797 (-)
AMCG00021250 NA coding downstream 1039056 11847323 ~ 11871511 (-)
AMCG00021258 diaph2,LOC107724831 coding upstream 128336 13044461 ~ 13090655 (-)
AMCG00021261 diaph2 coding upstream 270320 13186445 ~ 13192008 (-)
AMCG00021268 LOC100304549,LOC100219516,LOC106514001,LOC103353280 coding upstream 491237 13407362 ~ 13410923 (-)
AMCG00021274 LOC106604457,LOC108231309,LOC102198838,LOC103366979 coding upstream 522617 13438742 ~ 13441143 (-)
AMCG00021270 drp2,LOC106611717 coding upstream 539118 13455243 ~ 13488741 (-)
G84822 NA non-coding downstream 247248 12663009 ~ 12663319 (-)
G84812 pcdh19 non-coding downstream 407065 12500240 ~ 12503502 (-)
G84785 NA non-coding downstream 707740 12198777 ~ 12202827 (-)
G84780 aifm1 non-coding downstream 767204 12141960 ~ 12143363 (-)
G84778 NA non-coding downstream 777410 12131302 ~ 12133157 (-)
G85003 NA non-coding upstream 835081 13751206 ~ 13755469 (-)
G85009 NA non-coding upstream 920462 13836587 ~ 13837073 (-)
G85012 NA non-coding upstream 942179 13858304 ~ 13862544 (-)
G85044 NA non-coding upstream 1013717 13929842 ~ 13930281 (-)
G85058 NA non-coding upstream 1049811 13965936 ~ 13966910 (-)
AMCG00021259 diaph2 other downstream 108981 12719864 ~ 12801586 (-)
G84814 NA other downstream 382873 12527093 ~ 12527694 (-)
AMCG00021249 NA other downstream 809713 12093477 ~ 12100854 (-)
AMCG00021153 NA other downstream 5788076 7115420 ~ 7122491 (-)
G83864 NA other downstream 6363990 6544492 ~ 6546577 (-)
G84952 NA other upstream 711210 13627335 ~ 13627747 (-)
G85037 LOC100846954 other upstream 953814 13869939 ~ 13917868 (-)
AMCG00021302 NA other upstream 1032182 13948307 ~ 13951044 (-)
G85115 NA other upstream 1133849 14049974 ~ 14051897 (-)
AMCG00021304 NA other upstream 1141793 14057918 ~ 14071325 (-)

Expression



Co-expression Network