XLOC_006787 (si:ch211-67f13.8)


Basic Information

Item Value
gene id XLOC_006787
gene name si:ch211-67f13.8
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 35983997 ~ 35984530 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00013060
GGCTGGATGTAGTTCACAGCTTCTACTACAGTCGGGATCAGCTGGACCAACAATTCCCTCATTATATTAACCGCACCAGTCTGTTCATTCAGGAGATGCAGCGTGGAAACGCCTCTCTAAAACTGGACAAAGTGACTCTGCAGGACTCTGGCATCTACACTTGTTCCGTCAGCACAAACTCCGGCAGCCAGAAGAAGAGCTTTGCAGTGAATGTTGCAGCGCTCTACTCTGAGCCTCGTCTGCAGTTCTCCATGTTGACGGATGGAGTCAATCTGCTGATGACGTCAGATGGAGGATACCCTTCTCCAACACTGCAGTGGCTGATGGAGAACTCAGACATCACCAACCAGACTCAAACACACCTCAGACAGGACACACTCACAGGACTTTACATCGTGTCCAGCTGGATAAAACTCTCTGACGTCTCAAACTCTATATTGACGTTTATTCTGCACAACAGAC

Function

symbol description
si:ch211-67f13.8 Predicted to enable signaling receptor binding activity. Predicted to be involved in T cell receptor signaling pathway and regulation of cytokine production. Predicted to be active in external side of plasma membrane.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000079155

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00013060 True 462 mRNA 0.49 2 35983997 35984530

Neighbor

gene id symbol gene type direction distance location
XLOC_006786 zgc:153911 coding downstream 7011 35974362 ~ 35976986 (-)
XLOC_006785 BX510990.1 coding downstream 21531 35962350 ~ 35962466 (-)
XLOC_006784 NA coding downstream 58513 35925042 ~ 35925484 (-)
XLOC_006783 mycla coding downstream 75722 35904335 ~ 35908275 (-)
XLOC_006782 tacc3 coding downstream 91692 35880573 ~ 35892305 (-)
XLOC_006788 si:ch211-67f13.8 coding upstream 91 35984621 ~ 35985772 (-)
XLOC_006789 si:dkey-157l19.2 coding upstream 10708 35995238 ~ 36034582 (-)
XLOC_006790 lgmn coding upstream 53440 36037970 ~ 36050327 (-)
XLOC_006791 pcnx1 coding upstream 69455 36053985 ~ 36134401 (-)
XLOC_006792 med6 coding upstream 150592 36135122 ~ 36141486 (-)
XLOC_006471 BX537274.2 misc downstream 25719092 10264741 ~ 10264905 (-)
XLOC_006338 rn7sk misc downstream 35157772 825904 ~ 826225 (-)
XLOC_006779 BX663524.1 non-coding downstream 391620 35592242 ~ 35592377 (-)
XLOC_006775 CU138575.1 non-coding downstream 613313 35370569 ~ 35370684 (-)
XLOC_006774 NA non-coding downstream 694560 35205297 ~ 35289437 (-)
XLOC_006797 CR361558.1 non-coding upstream 414730 36399260 ~ 36399375 (-)
XLOC_006804 BX927407.1 non-coding upstream 603240 36587770 ~ 36612159 (-)
XLOC_006814 NA non-coding upstream 1011103 36995633 ~ 36997760 (-)
XLOC_006815 NA non-coding upstream 1025282 37009812 ~ 37012236 (-)
XLOC_006817 NA non-coding upstream 1125682 37110212 ~ 37110536 (-)

Expression


Co-expression Network