G15915


Basic Information

Item Value
gene id G15915
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 5411483 ~ 5411690 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17780
CAAGTTTTTTGCTGCGTTGAGCTTTGTTACCAACCACAGACATGACTGTTGAGCACATAAATGCAAAGGCCAATCAGAGGTGTTTAAATTAAAGCTGCTGACACACCACTCGAGCTCACTGACTTTCTACATTTTCGTAATGCTGTCATTATACCAATAAAGTGTAAACATCATGTAAACAAGAGGTTTATTGTGCACTGCAGACAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17780 True 208 lncRNA 0.40 1 5411483 5411690

Neighbor

gene id symbol gene type direction distance location
CI01000001_05401665_05402500 EMP3B, EMP3 coding upstream 8712 5401665 ~ 5402771 (+)
CI01000001_05365373_05384192 MYH7B, MYH7BA, MYH7BB coding upstream 27245 5365162 ~ 5384238 (+)
CI01000001_05279884_05287123 NA coding upstream 124104 5279837 ~ 5287698 (+)
CI01000001_05270301_05279405 AVPR2AB coding upstream 130676 5270301 ~ 5280807 (+)
CI01000001_05223340_05229184 IDH3G coding upstream 181824 5223340 ~ 5229659 (+)
CI01000001_05427300_05427801 NA coding downstream 15542 5427232 ~ 5427818 (+)
CI01000001_05478200_05480124 NA coding downstream 66510 5478200 ~ 5480504 (+)
CI01000001_05487409_05494726 NA coding downstream 75612 5487302 ~ 5495336 (+)
CI01000001_05498507_05500723 NA coding downstream 86520 5498210 ~ 5501377 (+)
CI01000001_05565644_05568075 NA coding downstream 153954 5565644 ~ 5568488 (+)
G15911 NA non-coding upstream 53581 5357630 ~ 5357902 (+)
G15854 NA non-coding upstream 69591 5337120 ~ 5341892 (+)
G15839 NA non-coding upstream 93490 5317486 ~ 5317993 (+)
G15895 NA non-coding upstream 127760 5283460 ~ 5283723 (+)
G15846 NA non-coding upstream 197231 5212269 ~ 5214252 (+)
G15948 NA non-coding downstream 10613 5422303 ~ 5422528 (+)
G15949 NA non-coding downstream 11879 5423569 ~ 5423775 (+)
G15950 NA non-coding downstream 12350 5424040 ~ 5424339 (+)
G15957 NA non-coding downstream 35611 5447301 ~ 5447941 (+)
G15959 NA non-coding downstream 37470 5449160 ~ 5449393 (+)
G15794 NA other upstream 346779 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 1790032 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 3740479 1667762 ~ 1671167 (+)
G13051 NA other upstream 4366331 1043713 ~ 1045152 (+)
G15995 NA other downstream 300195 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 2120882 7531541 ~ 7540586 (+)
G17234 NA other downstream 2620434 8032124 ~ 8032483 (+)
G17353 NA other downstream 3804332 9216022 ~ 9228859 (+)
G17354 NA other downstream 3822773 9234463 ~ 9240677 (+)

Expression


Co-expression Network